Tetraodon_nigroviridis Locus rpl13
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rpl13
Tetraodon_nigroviridis
rpl13
5
snoMBII-202, snoMBII-202
2183..2259, 3061..3144
4463
ATCCTGATGTTTGATTATTTATAATCTCATAATAACATGAAAACGACATGTATTAAATG
AAAATATGGGTCAAAATATAATCACAACAGTGATTATTAAAAATACAATGTGGTATTTCA
TATATAGGTTAATTTTTTTTTAAGCCAAATGTTACTCAATAGTGTAAAATGGTCATTTCT
ACATAGAAAAGGGGAAAAAAAATCATGCATGTGAGGGTACTCAAATACAATGTAGAAATT
AGCTTTCGCCGTTTCTTCAATTATGATTGTTTAATAATTAAACAATCATAATTATAATAG
GTAATAAAAAAAATGCTTTTATTACAACTGATAAGGATGAATTCAAAAAGAAATCCGTGT
TAGGTCTACATCTAGTGGTCATCCTATACATTACAGCATTTTAAACACATGCCACGTTGG
GCAGAAATAACAATATTGATAACAAAAATTTAAAAATGTATTAGCGTTCTATCAAACTAA
AAAAAAAAGTAAAACCCAGCGTTTTAACAAAAATAATTAGAGGCCTAAAATGCACTTGTT
TTTACGAGATTAAATAAAACCGAAAGATCACGTAGATCAATGGATTGATTTTAAATTTAT
ATCTCAGTATTCACGAGAAATAAGAGCTCTAAAGAGGATCTAGACACCTTTTTCTTTATA
AATCAGATCGCGTAAATATCAGGATCTACACTCCACACCAGTTGGTGGCGGTATTCACTA
ATTTGTTGCTTGTTAAACGCCAAGACAAACTCACAAAAGAAGAAGAAGAAGAAAAAGTAG
TAGAAGAAGAACGCTTGGATTTGTTAATAGTAATAATATACATGCAGTGTAGTACAACAG
CCTTAACATTATTATAGTTTTAGGACGTGGGAGGTTTGTTTGTTTTTTATTATTAATGTA
TAAAATTTTTGTACTTGCTGTCTTAGTCCTCTTTATTGGATATAGTCTCTTCGGTGATTG
GTTCGTTGAGACATATCCCACAACCCACCGAGCGTAACTTCCTTTTTCCTGTCGGCCATT
TTCCCCTCTTGTAGGTATGCGAATATTTTCTCTAACATTTTGTGCATAATCTACATTAAT
CCTCTTATTTTGACTCATATTTGTCCAGTTCACACAAATTCACGGACAGTGTGACTTATC
ACCTTTGTAATGAGATTAATATTGTGGTAGATGTGCTTTAGATTTGTTGTAAAACATCTT
CTGGCGATAGTGGTACACCGGTGTTTCTGTTAGCTTTGCATTAACAGGCCGACTTTATAA
CCCCACAAATAAAATTCAAAATTGCTGTGAGTTTTATAAAAAGGAATTTGACTTTTGGTA
GCTTTTAAACGAGAACTTGGCTTGTTCGCTCAGTGTATCATCTCATCTCTGAACGTCATG
ATGGTGAGCGTGATCGCATCCATGCGGCTCTGCTGTTTTGCAGGGACGTAAGCAGCCATG
GCCCCTAACCGGAATGGAATGATTCTGAACCCCCACTTTCACAAAGACTGGCAGAAAAGA
GTGCGCACCTGGTTCAACCAGCCCGCCAGAAAGATCCGCAGGTGAGAACTACTGTCTCGC
CCAGGGGAGAAGGGTGCTGTCAGTTTTATGGAAGTGTTGTCATTTATCTGTCTACAGGGG
TAAAATCACCATCACAAGCCTGTTCTTTTAATATTGGGGTGTATTTTGTTTGTAAATACA
GAGACCCGATCCCCCCTCTCTTTTAAATCCGATCAAACAATGCAGGTATGTTTTTCAGCA
CACTATGGTAACTATGGTAACTATGGACTATCTCCTGTAGGCGAAAGGCTCGTCAGGCCA
AAGCCCGTCGGATTGCTCCTCGCCCTGCTGCTGGACCGTTGAGGCCACAGGTTAGGTGTC
CAACTGTCAGGTACCACACCAAGGTCCGTGCCGGACGGGGCTTTACTTTGGAAGAGCTGA
AGGTAATGCTTTTTCTTTGTTGAGTTTATTTATTTCAATTTTGTTGTGCTGTTACTTTTA
ATACCATAGCTAGAGAACAGGCTAAAAGCAAGCAGAATTATAAAAGAGCTGCTCATTGTT
GTGACAAAAGCTACATCAGGGCGACTGCATCGCTGAACGAGTATTGTTAGTGCGTCTGCC
TCTGAGAATAAAAACCTGCATCAGTGTTGAAGGATTTGGTGATCAACAGAAATAGAACGA
GTGGTTTTCTTGCAGCAGTCAAGTGATGACAAATCTCCGGAATCTCTGTATTGACTTGAT
GAATACTTGAACCCATTAATCTGATACTGGCTGCATCGATTCCTATCAAACATTCTGCTG
TATTCCACAACCATGTGACATCCTAATGTTTATCTCTCGGTCGTCTCTGCAGGCAGCCGG
CATCCACAAAAAGACAGCCCGCACTATTGGCATCTCTGTTGACCCTCGTCGCCGCAACAG
GTCCACAGAATCGCTGCAGGCCAACGTGCAGCGCCTGAAGGAGTACCGCTCTAAGCTCAT
CCTGTTCCCCAGGAAGGCCTCTGCTCCCAAGAAGGGAGACAGCTCTGTAAGCTTTGTCCT
GGTTTTTGTTCCTTTTGCATTAAATGCTGCGAATGTTACTGATGAACACCGCATTGTGCA
CGTTATCAAAACGAAGAACCTGCTTATTTTTCTCGAGTTGATGCGCAAAACTCCCATGTG
CTGTTTCTCCACATGCAGTGGGCATCATGTTAATTAGTGTTCATCTAGGTGGATGTCTTT
GGTCCAAAGCTGATGAATCAGGGGTTTATAAATAGATGCTTACATTTATTTAATAACTGC
GTTGCATGAAGTGCTGCTTTCTTGTTTACCACATTTGTCAACCCTGAAACTGGACAACCA
GCATTTGTGAGGATCTGGCTTGGAACCCCCAGTAGGAGGGATATTTAAACCTTTAAGTCC
TGCAGCAGATCATTCACAGCACCGTGTCCTCTGTTTCCAGGAGGAGGAACTTAAGATGGC
CACTCAGCTCACCGGTCCAGTCATGCCCATCAAAACTGTAAGTCCCATGCCACGTTTGGA
TGGAGATAATAACTGTAATCTGATGGATCACGCTGAGCCTTGCTGGACTCCAGCAGTCAG
ATGATGACAAATCTCCGGAATCTCTGTACTTGCCTTTGATGAAACCCCTGAACCCTTTTG
CTGATGGCTGCTTTTAAATGTAGACCAAAAATGACCCGCATTTCCCCAAAGTGTCCCAGC
AGGAGAGCGTGTGTGGTCAGGTTTACAGCGGCTGGTGTGTGCGGCGGTGTTCACGAGAAG
CATCCCGATGGGCTTTCTGTTCCCACAGGTGCACAAGAGGGAGAAGGCCCGGGTCATCTC
CGAGGATGAGAAGAACTTCAAGGCCTTTGCCAGCCTGCGTATGGCCCGCGCCAACGCTCG
TCTGTTCGGCATTCGCGCCAAGAGGGCCAAGGAGGCCGCCGAGCAAGACGTCGAGAAAAA
GAAGTGAAAATAGTCACTATGGAGCTTTACGAAATAAAGTTTGTAAAAAGATAACTGAGA
ATGTCATCAATCCTACCCAGGTAAGATGGCGTGGTCCTGGTAACCTGGCTCATTTCAGTG
GTGCACAGTGGTGCTTCATCAGTTCATGTTTCAGCAGCAGTGTGACACCAGGCCCTGGGA
AGTGTGTTAGAAGGGGACGCGCTCCTCTGGGTGGGGCTAACGAACGCCTGCGTGATGCCC
CGCTCCAGCACTAGGTGGCGACAGTGACGAACATCCGGTGTTCAAGGGTGGTCGTGAGCA
ATTAACGACTGTCACAAATGCAGTGAGTTTATTGACGGTGAGGGGTAGAAGAACCTTAAG
AAGCTGGTGTGTGTCAGCGTTTCGTTTAAAGTGTTCTCTCGCAGCCTGAGTGCAGACAGA
CGATGTGAACTTTGCAGCACATTAAAGCCCCGGTTAAAGAAAAGCGGTGTCATTATGCAG
GAGCTGGAGGAGGGTCAGCAGACTATGGAAGGGTGTTGGCAGGACGACTCATTCTCGCCC
GGAGAGGTTCCCGTAGGCACACGCCGGCTGAAATGTGCTGCTAAATGTGAAACATCACTA
TGACAACCGACTCTGGGCCACTTTAAAATGTGTACCGCATTTCAATTAAGAAAGCAGAAA
TGATCATTCCCAGATGAACGGTGACAAACAGAGGGTCAGTGTCCTTGTCCGTCCTCCAGT
GTCCCCTGATCCATCTTTACTGGATGCTGATAAATTATTCAGAAACTAGTGTGTGGTTGT
CAGTTAAGCGGGCAAGAACCAGGCCTGCTTGACAAGGTTAAAATAGGTCAGAGTGACTTT
ATTCGATACGTTACTGCAAAAATAATCAAGTTACTCCACTGTAGCAAGGTCTCCAAGTAA
TGATTTCAGGAGCATTTTGCGTCTGTGTTTTGAATTGAGCGGAGTTGTGTGTCCGTGATC
AGCACAATATCAAACGGTTCACAAATCAATATCAGGTCTGATTAGCAGGAGTCGGAAGAG
GACGAGGGAGGAAACGGCTGGTCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1033, 1423..1540, 1780..1921, 2332..2505, 2920..2976, 3268..3463
1437..1540, 1780..1921, 2332..2505, 2920..2976, 3268..3426
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved