Tetraodon_nigroviridis Locus rpl12
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rpl12
Tetraodon_nigroviridis
rpl12
5
SNORA65, SNORA65
1890..2016, 2513..2639
3928
AATCACAAATCTGCCTCAAATGTCTCATCTTCCCCAACACTAAAGATAAACCGACTGGA
AATATAAAATAAAATCAGTGTTGCGTAAAATTAACCTAAAACAAATGTCTGATCACTTTT
TCCAGCTTCATTTAAAAAAAAAGGGGCAGGATGTTTCTTAGAGATAAAACTGTCCGTTTT
GAACAGAAGCTGTGAATTTTGAGGATCCTCGCAGATTTGCAGCATGAATATTAAACAGTT
CTGATCTCTGCCTCTCACCCACTTACTCCCTCTTGCGTTTCCAGGGCTGTGGAGCAGTTT
GACGGCTTTGGGAGGCTGAGTTGTTGTATCTGACACGGATGCAGCGACGGCGGTGATGGT
AGCATGACGGACGACGCGATGCACCAGGGATTACCGCTGCAGCATCGCTGGAGTAGCTGC
AGGCCCTCTATCCCGCTCATACGGAGGACGCTCATCCACTCAGCACCCACGTGCAGCACT
TTGGCCTGCTCTGAGTGAGGAACCAGTTTGGAAAATAACTGCAACCAGCAGCATAAAACA
CAGGCAAAACCACTCAAAATGACCTGTATGAAACTACTGCAGGTGCAAATACGAAGTATT
GGTAGTACTTTATGTTATATTGTGCAGCAATTACATAAAACAGAAGAATATGATCAAACC
ACACGTGTGTGGACTATACAAGTAAGCAGACATTATTCTTCATTCAGTTTAATGTAAATT
TAGATAACTATTACTGTCACAGCTAGAAAAGCACCGGGACCTCCGCCACGCTTTGGAGCC
TTCGGCCATTAATCTTTCAAAGATCAAAGTTTTCCACATTCTGGACCATTAAAATTACCT
AAAAATTCTCTCATAACTTTGTTATTTACTGAGTCTGTCAGATAAACTCCGCTATGGCAG
AGGCAAGATGGTTTGCCCCGCCCACGCACGCCATACGTCATTTAAATTACGCGTCATCTC
GCGATACTTGCGTCCCTATAAATGCGTCCCGAGCGCGAGCTCGGCCTTTCTTTGTCCCCT
TAGCGGTGAAGGTGCAACAGTGATCGGTCGTCCCGACTGCGGGTTCATCCGACACCCTCA
CCGACCAAGCTGAACTGAGCTCCAGCTCCGCGGCAGCGCCATGCCTCCCAAATTCGACCC
CAACGAGGTTAAGATTGGTACGTTTCTGGCGTCACCTCGGTAAGACGTTTGTTCCCAGCC
GGGATGGACGCTGCCGCCGCGTGTGGCTGCGGCCTGGGCACGGCGCGTAGAGAACGGTAA
TAAAGGCACCAGGATGCCACGAAAAAGGCAAAGGAACAACTGAATTTAATGTCTGCATGT
ACTTATCGTAATATAAAGGCATGTAATGTTTTTGAGCGGTGTGTTTGGATCCACGTGAGG
GGCTAGCCAGTGGAGCTAATAAGCTAACGGCTAGCTTGGCAGAAACGCAACTTGCACTTT
GTAGCTCAATAATAGCGCGATTTTAGACTTTCTGCTGTTATTGGTATCAGATATAGAAGG
GTGAACTTGTGTAATAACTTGAACACAAACAGTTCCCTATTTTAAGTTTGTTTTTTGTTG
TTGTTACAAATATTGGCCTTACGTGACTGGGGTGATTTTACCTTTTCTGAAATTATAAAT
GTTGGTGGCTTTTAGTAAGGGTTAGGGCAGAAGCAAAAACCAAATCATGTTGCCGGTGCC
CATAAAATTATCACCTTTTTAAGACGCAATTTACTTTTTTTTGTCTTGGTGATGCTCTTT
GACGTTCTACAACCATGTATATTTGGTGCTTTTCTCTCTTCTAGTGTACATGAGGTGCAC
AGGAGGAGAAGTTGGAGCCACCTCTGCTCTGGCCCCCAAAATTGGACCTTTGGGTCTGGT
AAGTACGGCCAGGAGTCCCAGTTCCAGCCTCCCGCCACTACACCAGTCTGCCAGGGTGAC
TGGGTGTGCTCCAGTGGAGGCTCAGATTAACCCGGCTTTAGGAAACAGGGCTGCCCGACC
CGGTGGGCATCTCTGTGCCGAAAAGTCTGGAACAGACCCCTCAGTCACCCATCTGCTGTC
GTGATTAGTTGAGCCACATTTTCTTTTCTCTTCAGTCTCCAAAAAAGGTTGGTGACGACA
TCGCCAAGGCCACGGGCGACTGGAAGGGTCTGAGGATCACCGTCAAACTGACCATCCAGA
ACAGACAGGCAGCGGTACGCCCCGCCCTCTTCCCCTCTGGTGAGGATGCTGATGTAAAAA
GTGACCGTGGGTGTTTTCCAGATCGAGGTGGTTCCGTCTGCATCCGCTTTGATCATCAAA
GCTCTGAAGGAGCCTCCTCGTGACAGGAAGAAGGTCAAGAACAGTAAGTGTCTGCCACAG
GTTTCTGTTTTTAATGGTCTGGTGGGACCTCACTCATGAATTCCTCCTTTGTAGTTAAGC
ACAGCGGGAGCGTGCCCTTTGATGAGATCGTGAATATTGCTCGCGTGATGAGACACCGTT
CCATCGCCAGGGAGCTCTCTGGTAAGGGTTCATCCATCCTCCCCTCCGAGCCTCCCGCCA
CTACACCAGTCTGCCAGGGTGACTGGGGGTGCTCCAGTGGAGGCCGAGACTGACCCGGCT
TTAGGAAACAGGGCTGCCCGACCCGGTGGGCATCTCTGTGCCGAAAAGTCTGGAACATTT
TAGTTTCAGGAACCAGATCTGTGCAGCTAGCAGCCACTGATCCCAGATCAGTGATCTGTC
GCTCAAGTGTTCTGGTCTGGTTCTGCTGTGATTGACAGCTGCAGAACAAACTCATTCGGG
TCTGTTTTCCTCCTCTAGGAACCATCAAAGAGATCCTGGGAACCGCTCAGTCGGTTGGCT
GCACCGTCGACGGACGCCCTCCCCACGACATCATCGAGGACATCAACAGCGGAAAAGTCG
AGTGTCCAACCGAGTAAACACAGCGCAAATAAACGATTACAAAATCCAATTTATTGTTTT
TTCCGTTTTATAAATTGTGCACATCATTCCATACATAAAATAGTTATCAAATTGTTCCAA
CTAACAAACAAGTGCCTGTAAAACCCGGCTCTGGCAGGTTCCAGGAACCCAAAGGTTGTG
ATTGTAACTGATCAGGGATCAGCTCATTGGGGGACGGGAAGGTTCCTGGTTCTTCAGAAC
CAGGAACCTTGAGCAGGTTAGAAAACTTGGAATCAGAAATTGGCTCTGAAGAACTAAACT
GAACTAAATCTGACCGAGTTGTTGGTGTGGCTCAGCTGTGGTGGCCAACCCCAAAGCTCC
GCTGCAGAAGTGAACATTTATTTTAAAAAGTTGGGAAACCGTGGAAGTTCTGCTCCTGTG
GGGCTGGGCTGGTGCTGGTGTGATCCAGTGACGTCGCTGTGATGAACAACCATCAAAGCT
CAGTTTTCCACATCCTCCTCTGCTGCTTCAGGCTCCTCTTCCATGCGCTCTTCCTCCTCG
TCTTCCTCCTCCTCTTCTTCTCTGCTCTTGTCCTCGCTGGTCTTCTTCTCTTTATCTTTG
CGTTTCTGCTCAGACACTTCCTTCTTTCCTTTCTGGCCTTTCTTGTACACTGAAGAACAA
AACACCAAAAAGTAGCGAGTAAACAAAGTGACGTTTGAAGGTTGGCGTTTCCATCTGGCG
ACCATCGTATCCTGATGTTCTGACCTTCCAAAGCTTCTTTTAGCGGCTCCAGGAATCTTT
CAAACTCCATCTCTTCCATCGCAGCTAAAACATCTCCAGCATTAAGAGTTTTGCGTTTGG
CTTTCATGGCAAAGTTGTTTGCACTGTGGCAAAGAGGAAAAAAGAAATTCTTAAAAAAAA
ACCTGCAATCTGCAATTGTTCCCATCCAGAAATGCGTCAGTGGCTCACCAGGATGTTGCG
TATAACACAAAGACGCTGGCAGCTTGAGAAATCGCCCTCCTGGCTTCTTTTGACACATTT
ACCCCATCTGGAAGCTGAAGAAAAACACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1156, 1784..1857, 2075..2173, 2241..2322, 2394..2480, 2778..2928
1120..1156, 1784..1857, 2075..2173, 2241..2322, 2394..2480, 2778..2896
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved