Tetraodon_nigroviridis Locus Mono:SNORD67
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Mono:SNORD67
Tetraodon_nigroviridis
Mono:SNORD67
5
SNORD67
1001..1114
2114
TTTTCACAGCCAAGGAAAAATATCCAAAGTGGAAAGTTTGTACAGGGTAAACTTTTTAA
AATATAAAACACTGATGCTGCACAGAGGTTAAATGTTTGACCCCGCACCATGAATAAGAA
CTGATGTGCTATACTCGCTGTAGCCACTTGGGGGCAGTCTCCCCCAACAAACTTGGAAGA
CAACTTTTAAGATTTATCATCAATGGACACATAAACAGGTCCAGCTGCACACAGAGATCA
AACTTATCGCCTGGCTGAATAATAACCTACACGGAAAAATACGTAAATAAAAACGGCTCA
GAAAACGGGGGATTCGAGTTTCCCAGAGTGTGACTGAAAACACTGGGGGGGGGTGGGGGG
GGCGCTAAAGCGATCACGTGATCATTGCCCACTTACCATTGGTCGTTAAACCGGAAACGG
ATACCGACAAATAAACGAGCGGGCTGTTCGGACCAATCCGAGAGAACTGATCAACCACTG
GCCGGTCTAAAGGAAAGAAAGTGGCTGCAAACAGGCATTCTATCACGAACGATCAAGACG
AACATAAAGAAACATGAAGAAAATGAAGCTGGAGATGAAGGTATGAAAGTGTAATTGTTC
AATATCTACCGCCCACGCAACATAGGTTGTCAAATCAAGGACGGTGTGATTTATTTGCTA
ACAGCAGCTGCTACTTGTTAGCATAGCTAACAATGACACGCTATCGTGGCTAGATAGCGT
TAGCTTTCTTAAAAACTTTGCATAATCATAGAAACCCAACGATATAGCTCAAACATTTCC
TTTTAGTTTCTATAAATACACGACTGTTGCTGATATGTTTTTGCTTGTTACGTTCCAGGC
CTTCGGCCCCGCACGCGCCTCCCTCTGTGAGCCAAGCGAGAACAGACCGGATTGAACTGG
CTCAATGACACAGCGAACACGAGGTAAGAGCAACGCATTTGGCTCTGCGGTTAAATTCTT
ACCTGTACCACCGCGTGTCGATGATTCCTGGTGGTCGTGGGTTTGAGAGTGATGAGTTGC
ACGAATCAGTTGGGGCGCTCGGTGCAGTGGCAACGGCGCCCCAGTCCGAGCAGCGCTGAG
GACACCCTGGGTGCACAGGGGCCATCTGACTCAACCCTAACCCTAACCCTAACCCTAACC
CTTACCCTTCCAGCAGTCACGGGTGTGCTCCCGGCCAACGCACTAGCTGATCGCTTCTGA
ACAGGTTGAGTAGAAAACCTGTCTTACTCGTGGCCTATTGTCCGAAGCAGAACAGCCATG
AAACTAGTTTTTCATCAGCGATCATTTATACCGTCGTTGATTCATAGAAAGCTTTACAAA
GTCATGCATTGACTGACCTTATTACTTCCACAGATCATCTTCGGGGTGTGTGGACGTCTG
CTCCGCTGCTGCCATCCTGCTGGGCTGACTGGTGTCTCTGCACTCCAAGGTGGGTTTCTG
CCCATTTCTAGCGTTTAAAATCCACAAAAAACAAAAGAATCCGCTTCATTTAACTGTGTG
CTGTGTTGTGTCTTTTTAGCAGCTGAACTGATGCTGTTGGATCATGGGACGGAAGCAATC
TGCAATAGCACCCAAGGGCTGGAAAACAAGCTGCAGATGATCAAATGCGTCTCCTGAGCA
TAAACCATAAATGTTTCATTCACTGGACATACTGATGTTAATAAAGATCTGAAACATCCT
CATAATTGCTTCAGGTGAATTTATATATTTAAAGTATGCTTTTTACAGGTCAGGCTAAAA
GCCGCTGGGTCATTAAACTGGGGGGGTTGTACCCGGGTTTTGCCACCAGGTGGCAGTAAA
ACACCGAACGTTCTAGCAGGTCTCCGGTTCTTGAGTTGACACCTGGAGATCATGTAAAGC
TTTCAACGTTTTCAGAACAAGTAAGTAAGGACCAAATACTGAACACAGCTTTCAGGAATA
TTCCTGAAGGACAAACATGAAGCTGGTCTCACCCAATCAAGCATTGGCATCAGTCAGTCA
CTTGTATGCTGTAAACTATAACTCAACCAAGACAATCTATATATTTAATGTATTCTGTCA
GTTCCATTCACACGGGCACTGGGAGGAGCTAAGGACCACCAGCGAAGGGCCTAACCCAAT
CCAAAACTACCTTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved