Tetraodon_nigroviridis Locus rpl7a
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rpl7a
Tetraodon_nigroviridis
rpl7a
4
SNORD24, snR47, snR47
1160..1240, 1836..1894, 2104..2176
3981
ACAAGTAGCGCCTAAATAAAATATGTGTAACATAAACAAAGCCACAATATGCTAGTATG
GCTTTTAGCACAACAACAGCAACAACAATTACTGCTACTGCTACTACTGCTACTACTACT
GCTGTTTTACTGTAGTGTAAAAGCTCTAATATTTATATATTTTTTACAAGTCAGAAGGAG
TGCAATCAAGCCAGATTGTTTCTCTGACCGCTGATTTAAGATCTGCGTATTTAAGAGACG
TAACCACGTTGCAACCCCGGCGGTATTTCCGCTACCCACAATGCCTTGCTCTTCCTTTCT
GCCTGAACCGACATGGTGGGTACATAGGCTGTTTTCCTCTGGAGTTTTTGTACATCTTTT
ATCACTTTCCATCCATTTGTTGTCGTAAAGTCTTTTATGGCATATTGTACATGTTTGTTG
TTAGAATGCTGTTTTAGTGCATAATGTCAATATTGTCTGTAGATGTTGTTCTATTATTGC
ATAAAACTTGGTTGAAGTTATACTAGCTTAGCCGGTCTGGATGCAGTATAGCCCTGTTCG
AAGCTAGTGCTAACGTGGGTAAACGTGACTAATTTCATTGGCGTTTTTTGCTGTGTTTAG
GTTGTTTTTGCCTGAATGTCAAATTTTTATTTTAAACATTTGAACAAAATGTTGGCTCAT
GCAACGAAACTAAATGTTTCGTGTAACTGAGCTAGAGGGAGATCAATGCCGTCATAGCTA
GCCGGCTAAAATGGACACAGTATACGTGGTTTTATTATCAAATGTCGTAGGTACGTTATT
TAATAGATTTCAGGAATTGTTTAGTAAATGCGTATGTAATTTGGATTTTATATTGCACAG
CATTGCTAAGGAAATCATGCTATGTTTATAGCTCTTCAGAAATTTAGAAATAATGGTTTA
AAGAATTGACCATTTCCGTAGTATTAGTTTAGTATAAATTGATTATGTTCCTCAAAAGTT
TTCTTGATTTGACAAAGGTGGTTTGACTAAAACTACAACTCTTTTCTTCACAGCCCAAGG
GAAAGAAGGCTAAGGGGAAGAAGGTGGCACCTGCCCCTTCAGTGGCCAAGAAACATGAGG
CCAAGAAGGTAGTCAACCCCCTGTTCGAGAAACGGCCAAAGAACTTTGGCATCGGTAAGT
GCCCTCCAGGGATGAGAAAAATAGAAAGTGCATGTGATGTAAATGAATATTTGCTATCTT
AATGCTACTGATGACAATATTCCACCAAGATCGCTGATGCACTTCAAACTGAAAAGCAGG
AAGCTCAGCATTTGTGCAATGATTGCTGGTTTTTAAGAAGTTTATTATATTTCCAGGCCA
GGATATTCAGCCGAAGCGCGATTTGACGCGCTTTGTCAAATGGCCTCGTTACATCCGCCT
GCAGAGGCAGCGCTCCATCCTCTACAAGCGTCTGAAGGTCCCCCCTGCAATCAACCAGTT
TACCCAGGCTCTGGACCGCCAGACTGGTAAGTTAATTTCAAAAAATGTGGAGACTGAATT
TCATTTTAAATAGTCCTCTAGCCATTTAGCACATGGCACACTGGGCTTTAATTGACTTCT
TTGTTGCTCAGCCACACAGCTGTTCAAACTTGCCCACAAGTACAGACCAGAGACCAAGCA
GGAGAAAAAGAAGAGGCTGCAGGCCCGTGCTGAGCAGAAAGCAGCTGGAAAGGGGGACAC
TCCTACCAAGAGGCCCCCTGTTCTCCGCGCAGGTTGGTTATAAATGTACATATCATTGTC
TGTGATGGTGAATCAACCTAATTTATTGGTTTAGTGTCATTTGACGATAAACTGATCGGC
GGTAGATCATGAGTTCATGGCCCGAATGCAGTGATGACTTGAATTTCTTCACCTGATGGC
TTCAGTGATGCGTATTGAGCTTTTTAACCCTGAGCATTGGCCCAAAGTCTATTACACTGG
AATCTGAATAAGAGCATCTGAATAAGAATGTTTCCCTACTTTCAGGAGTGAACACTGTCA
CAACACTGGTGGAGAACAAGAAGGCCCAGCTGGTCATCATTGCCCATGATGTTGACCCCA
TCGAAGTATGTACCTTTGTCAGCAGCAGTGAAAATTACTGGTTGGATTTAAACAAGTGGT
TCCTTGCAATGATGTTTGAATTTCTTCACCTGAAGTCACTGTGTAGATCAAAACAGACGA
GCTTTTTAACCCTGAGCAAGGGCCTCAAAGTTCAAGTCTCTTCCATCACCATGTCCCTGC
GAAGCATTAATGGTGTCTCTGCTCTTTCAGCTTGTCATTTTCCTGCCAGCTTTGTGTCGT
AAGATGGGCGTCCCGTACTGCATCGTCAAAGGCAAGGCTAGACTGGGCAGACTGGTGCAC
AGGAAGACATGCACTTCGGTTGCCTTCACACAGATAAACCCGTAAGTTTAATGTTGGCTT
GCAAATAAAGCAGCATAAACACCGCTGTTACTCATGTTCTTAAAATATAAATGGACAAAA
TAAAAATTTTATTTTTGATCACTGTCGCCGTCGTTTATTGACGAGCTCTGTTGTTTTCTA
GTGAGGATAAAGGTGCCCTTGCCAAGCTTGTGGAAGCCATCAAGACCAACTACAATGACA
GATATGAGGAGGTTAGCGTTTTCATTCTAACCAGTGTTTGACACGTTTCACAGGATGGAC
TGAACTATTCTAACTCTTTTATTCCTTTCTCAGATCCGTCGTCACTGGGGTGGTGGTATC
CTGGGTCCTAAATCCACAGCTCGGATCAACAAGCTGGAAAAGGCAAAAGCCAAGGAACTG
GCAACTAAGCTTGGATAATTTGTTTGGAATAAAAAAAAAAGTATCCTTACTGAGAAAGTG
TCTTTATTTCCATGTTAAACTTTATAGAATGTGCATCTGTGATTAAATTTCCGCCTAATT
GTAACAGAACTTGCAAACTGACACGTTTTTATTTTTTACTTGCAACTTTCTGAAAATCTG
ACACTCGTTTGAGACACACATAAAAAAAATTATTACATTCACCAAAATGATATTTAAATT
TTTTGGATAAACTTGGCAAACCACATGTAAGAGGTTGCAGCACACAATCCGTACCTGGAG
AGAGGAAAGGCATGAGTTTGATGGGGATCATGAAGGACGTACAGGACGAGTGCAGAGAGC
AGCTACCCACCATGTTACTATGTACTGCATGTGCTCGTTCCTCAGGGTGACCCTGGTCTG
TCCACCTATGGGGCCACCAGGAACTGTGCTGCCTGGGTGACAAGGTGGTGCTCAAGTCTC
CATAAACCCACAGCCCTACCTAACCAGGAGTTCATTACTGATGGTCGTCTTACCAAAGTC
TGCATCGATGAAGATGGGCTCCGCTCCTGTTATCTGACACATGGCCTCCAGGTCCCGGTA
ATGCCAGCGGTTTCTTTCCACGTCATTGTTTGGTACAAAAGGTTTGCGAGTCTCTGTCAG
TCTAACTACACCAACCACCTCCATTTCACCCTCCACCTGCACATGACAGGGAGAAACCTG
TAGTCACTGAAGTTCTGCCACTGCTGGAGTCTAGGTTTGTGTGGTTAAATAACCGGCAAA
AAGAGGCTGAGCAACGCTGACCTGTCCCTTCATCCTGGTTTCCGGTCTTATCTTCTGTTT
TGGGACGTATCCTCTGTTCACCAGGATAGTTATACTGAACGTGGTGAAGGAAAAGAGAAC
TCAGATCACATAAATTTACTTTTACAGTAGAAGAACAAGGTCCTACCCCAGGTCGGTACA
GTGAAATGGCGTTATGACATTGGCACCGGTCTCTCCGCTTGAAGACAGCCTGCCTGCCTC
CCGGGCCTCTTTCTCAGGGTCGACCGGTGAGCGGGGCAGAATGTAGAGCTCCTTGGAGTG
GTCGTACTTCCCTCGCACTCTCACCCTTCTGTACTCCAAACCGCTCAGTTCAGCAGGGCT
GGTATTCAAAAAGAAGGATCACAAGCAGGCCTGCACATTAGAAACCTCATTCTCTGTTCA
TATTTCTCTATATAATCTACTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1133, 1316..1465, 1571..1711, 1965..2044, 2250..2380, 2521..2590, 2673..2981
1001..1133, 1316..1465, 1571..1711, 1965..2044, 2250..2380, 2521..2590, 2673..2777
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved