Tetraodon_nigroviridis Locus rpl17
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rpl17
Tetraodon_nigroviridis
rpl17
4
SNORD58, SNORD58, SNORD58
1593..1660, 2270..2335, 2915..2981
4128
GTTTCAGTGTTAAAGGACAACTTCGGTTCCTTCCACGTGTACATATCTTCTCTGTGCTC
ACAGCTGAAAACAGACAGGAGCTGTTGCTGTGTCTGTGTCCAGTTAAATGCAGCTGCAGG
AACCATTCCAGCTGTCAACGAAGCATGGAGCCGATGTAGCCTGGTTAGCCTAGCCTAATT
TAGAGATGAGCAAAAATGGCTATCCCGATTGGTTTTAAAGCTAAAATAATGTTTAATTTG
TGTAAAAAAAGTTTTCTCCTTAACATGTTGACAAATAATTATGCAGATTATCCCCAATAG
TAATTGCACATGTTGGTGATTGAACCACAGCTATGGCAGTTATTGATCCTCCTGCACCAT
GTTTGATTGAGCATCATCAGCTGTTCCTGAAAGATGCTAAATTAAATGCAAAAGATGAGG
AATTTGTACAGATATTCATCAACACTGTCCCCTCGGAGCTTTCGTCATGAAACTGTGGGA
AAATTGATGATGGAAAACTGCATCAGGCATTTTTCCACACTTTTTTTTAAATTACACTTC
TGAGTGTTTCTCACTGAGGAAATGCTGTACTAGATTGGGAGGACTTTTTTGTCTAATGTA
AATAATATCTTTATTTTTGTATGTTGACCTCTTGAGCTTTGACATCATTTACAGTGCAAT
GTTGTGCATGACCCACAGTGAGTGCACAGTTTTTTTTTCTTTTCAACTGTAGCTGGATCA
AACCTTTCACACTGCAACATAAAATACCAAATACAAATAAACCAATAAATGCTTTAGTAC
CACTCTTAAGTTTTTTATTGGTATTTATTCATTTACATCGCTCACTATTACACTTTATGT
CTCTGAGGCCATTACAGTTTTATTGCTAATCATTTGCCACAAACAATAAATAAAGCGTTT
TATAATGGACAAATAAGGCCTACAATGGCGTATGCTGCCACCCAGTGGCGAAAGCGCGCT
ACTACAGCCTGGTGTTTTCCTCCGAGCCTGCAGGGGGCAGTAAACCTTAAAGGAAGCAGA
AAAAGCGTGGCCTTGTCCCCGGTTCTTCCTCTTCCTTTCGCGGCCTCAGAGGTAGGAGAC
CAGTCCTGCATATGAAAACAGAATCTATGTTTAATCTTTACTAAATCTTTATCATCCGAC
TTTCTCGACTTCGCGGATTTATGCGTCAGTGTTGGGCGCATTGAAACATGATAAATGTTT
TAATATGGAGATGGCGAATTAGTTTAAATTAGACATTTCTGAGGGTGCCGGTTTGGTGGC
TATCGCGTCATGGATCCGCCATGTTGGCACGATTAGATGATTAAATTGAAATAAACATAT
TATTTGACACTCCTTACTTACTGGTATAACATGGTTTTATGATATCACGTTCACGTCTGT
TTACAAACGCAACCATCTCTCAATGACAGAAATGACCGACTTAAGCTAATGCTAACTTAG
CAACCAACTGTGCAGATCTATGTAGTTTTAACTCGACACTAAAAATGTCCTTTTTTCTCG
CAGATATCTGAAAATGGTCCGCTATTCTCTCGACCCCGAGAACCCGACTAAGTGTGAGTA
AACCGATGTTTCTGTGCTAAAGCTGTTGAACGGATGCTGTGATGACTTCTTAGGACACCT
TTGGATTAGTCATGAAAATAAAAGTGAATTACCTGAGCAAACGCGTGCTGCACACACACA
CACGTGTGTATTAGCAGAGCTCTTTTCTAATATCTGGACTTTATTTCAGCATGCAAGTCG
AGGGGCTCCAACCTCCGGGTCCACTTCAAGGTAAGCTCGGTTGTCCATTCGTTAGGATCA
TTGTGTACGTCTTTCCCACACCATAAACGCATTAAACACACAACAGTTTTCACAGGTATC
CTTTTAAACTGCACACACACGGTTTGCCAGTCGCTTCAATGTGACCCACCCTTGTATGAA
TTGTAAAAATAGGAATTGTCATCAGTTAGCAAATGGCTTCCATTGGTATCACTGCTAATT
ATTCAAAACTTCACAGAGCGTTTTACAGCCACAGCTATTGAGAAGGTCTATGCTAGCGCC
TTTGTACTAGTTGTTGCTGAAAATGCCTGTTTTGACCCCCCAGAACACCCGTGAGACGGC
CCAGGCCATCAAAGGCATGCACATCCGCAAGGCTAACAAATACCTGAGGGACGTGGTCGT
CAAACACCAGTGTGTCCCTTTCCGTCGTTACAATGGCGGCGTTGGAAGGTGTGCCCAGGT
GGGTTCGAGGTCTCCATAAAACGTGCTTGTCGTGAGGTCCGTCTGAAAAACTGCGGTGAT
GACTATCTTAGGACACCTTTGGATAAACGATGAAACTACTCATGTGTCTGAGCACCTTCT
GAGGACAGACTGACTCCTCCTCGAACAGAAACGGTCGTTGTTAACATCTCGTTTCCCCTC
GTTAAGGCCAAACAGTTTGGCTGGACTCAGGGGCGTTGGCCCAAGAAGAGTGCAGAGTTC
CTCCTTCACATGCTTAAAAACGCCGAGAGCAACGCTGAGCTGAAGGTACGGCTACACACT
TCTTATTTTGATAGTTTTGCTGCGGTTTGTAGATTAGAAAACTGGAAGCTGAGGACAAGG
AGACACGTTGGATCTGCTCCGGTTCTCACCAGCCTTTCTGGATGATTTGGATTTCAGGGT
CTGGATGTGGACTCTCTGGTGATCGAACACATCCAGGTCAACAAGGCCCCCAAGATGAGG
AGACGCACGTATCGCGCCCACGGCCGCATCAACCCCTACATGAGCTCTCCGTGCCACATC
GAGATGATCCTGACCGAGAAGGAGCAGATTGTCCCCAAACCAGAGGAGGAGATCGCTCAG
AAGAAAAAGGTAGGAGGCTGGAGTTGGGTGCCGTGTTCAGACAAACCGGTGTTTCTGTTT
TCTGCGTTTGTCTGAACACGCTGGCCCCACAGATGTTGCACTGATGACCACTTAGGACAC
CTTTGGATGAACCATGAAAACAAACTGTTAAACCTGAGCAGCACAACTGTTCAGTTCAAG
CTCTGGCGTCGCTACGATTGTGGTCGTTAACGTTGAGTTTGCTCCGCAGGTTTCACAGAA
GAAGCTGAAGAAGCAGAAACTGATGGCACGGGAGTGAATCTGAATAAAAGTCAACACTTG
TTAATAACATTTGAGTGTCAGCTGTCCTTATTTACTCCTTGTGATTAGCCTAGCCCTGTT
TATATTCGGTAACCTTCTGAGACCTACTAAAAAATTTCTAGTAAACTTTAATATCAAACA
CCAAGAGTGAAGCACAATCACATCTCTGAAATGGCCAAATTCAGCCAGACTGTTACCGAG
AAGGCAACAATGTCCAGGCGTTCTCTGGTAATCAGACTCAAATTGACCAGTATGTTTTCA
TTGATGTCCTAATTGTTCATGTCAGTTTCAAATTTTATTAGACTGAAGTCCATGTTGGAT
CAGGGCCTTTGGCTCCTGGGCATCAAGATCACTGTTTATAAAGTCTTGGAGGTGGCAGAC
GGTCCCTGGTAGACGGGCTTGCACGTAAATTATTACTGTAACCAGCTTAATTTGCTGTCA
TAATGCACAAAGTCCCGAAAGCGTGTTTTTTTGCTTCTGCAATCCCGTGAATGGACACTC
GGGGGCGCTCTGAGGTTGACTCCGGCGGCCTTAACCTGCCCTTTCCTGCCGCTTTTAAAC
GACAGAGTACATTTATTTGATCACGTAAACAGTTTTTAAAATGGAACTGCGTTGCGACCG
TATTCCGGTCTGGATTTTCTTTAAAGACTGAAATCAATAAACTGATCAATATATTAGGCC
TGCTTATCAGGATCAGTGAGAAATTAAGGAAGATTTCCCAGCTGTAAAAGTGTAAGATTG
TAGCAACAACTAGAATGCTTTTTTTTTTTTTTTAAATTTAATTCTAAAATCATTCATAGC
ATAGTGACGTTTTGCATTTTTAGTTGTCCCTGTTAAACCTTCGCAAAAGGACACTTTAAT
TATTAGGTAATGTGGAAAAAAAAATCGAAATCTTCTGCAATTAATTGCTCTCAGCACTTA
CACTGACCAATACAGTGCAAACATTTATGTTTGATAAAGGACATATTATTTATCTCAAGT
AAATAAAAATAATTATTACAAAGGTCTTGTCAGGCAGTAACACGTATTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 1503..1552, 1729..1769, 2083..2217, 2406..2504, 2637..2828, 3049..3128
1513..1552, 1729..1769, 2083..2217, 2406..2504, 2637..2828, 3049..3096
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved