Tetraodon_nigroviridis Locus Mono:SNORA50
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Mono:SNORA50
Tetraodon_nigroviridis
Mono:SNORA50
3
SNORA50
1001..1132
2132
CTTCGGGATACATGTCCGCAACCAGTGGAGGAGGAGGAGGGGGAGGGACCAGAGCTGCT
CCCAGCCAATCAGAGCAGACCTACACACATATACACGGATATGGGTGAAAACACTTCCGG
GGTCATTTTCTGCCGCACACGCCAGGAGTCCACGCGGCTCGTCCGTGGACCGACGGACCG
AAGTTAATTTCAACATGATTAGGAAATTTGTACGTCTCAGGGTTCAAAATCTAATTCGCT
TTAGCATTTCATAGAATATGTTGCTTTAGATTTCAAAAGGTAGGTTCTTAAAATGCAGTA
ATAAAGGCGACCTCGAAACACCGTGTGCGTGAGAAGGTGGCGCTAGGTTTGTATTTCTTT
CCTTTTTTCCCCCCCTCCCCAAATCTAAATAATTACCAGCGCAAACAACTTTATTCCAAA
GTTGCAAAATGTTCTCTCCACAGGCCCGGTGACGAATTCTGCTCGGAGCTGCTGCAGGTC
GACACGTGGGTGGCTCAGACCTGTATTTCGAGATCAGGTCAAGTTGAGGTACTGTGGAGT
TTACCCACGAGTTCAATTTATTTAGTGCAAATACTGAGTCCATGAATGATGTTTTTATCG
CGTTAGACTTCTGATTTGAACATGAAGTCAACTCTTAATCTGACATGGTCGCCCGCGGCC
AGTGTGCGCGCCTGGGTGAGGTGGACATTTTATACAAGACTTTTATTTCTCTTTGCAGAA
TTATGGGTCTTTGAGTGGATTCTTAGCCTGGGAAACAATATAGGGTAAGAATGTGACTTT
TTACAAACAATTGTATCTGACATTGCTTCTCCAAAAAAGTCTAAATCTACAATTTAATGT
TTCCCCCTTTTGCAGGTGTTGATGAAGCAGATGCAGCAGAATTTGTCCTAAATCCTGAGA
TTGCAGTTAATAATTCAAGTTTGTACCTTTTTTTATGCAGCAGAGTATCAATATTAATAA
AAAAATAATTCCTGAAACATGGTTTATTGATTGAGTCTGACCAGCACTCCACTGAACCTA
ACGGGCTTTTCCGTGTCCGTTCGCGGGTCAAGCGGAGTGCGAGACCATATCTTGTCATAA
CTGGGGTTTCTTGGCACTGTCACCAAGTAGCTCTTTTAAAGCAAGACACACTTTTATATC
AAAATAACTATTCTCATAACTGCAAAATAAATTCTCTCTTAGCTAAATCTTGTCATGAGC
AGGATTAATTGGTCCCTGTCAATAATATTAAAGGAATAGTTCAGTGTCAGTCTTGTAAAA
AAAAAAAAAGTTGCCATGGATAATTTTTTGGCAAAGCAAAAGTATTTATTGATCCAACAA
TGATCAGAACATTCTGACATCACTGAACACAACATTTCAGATTTGAAACACCGCAAATGC
GTCACCGGTGAAAAACGAAGCGCGCAGAGACAGAAATGGCACAAAGACGTTTTCTCCAAC
TAATGCGACAAACACGCTGGCACACTATGGAGGAATGTTTGAACATTTTAAAGGCACTTG
CGCCTCGTACGCTTTGCCAACACGCTTGAATGAGAAATCAGGTGGGTGTCTTGGCAGATT
CCGACATTTCAGTTGTGGTTTGTTGATGTTCCTCATTAGCAAATCAAACATTTTAGTACA
AAAGGACTCTGTATTAATGACAGGTTGACAAATCATATGGCTAATATCCAGTATTGAAAT
TAAGATGGCTGTCTGTTTGTTCCTCTAAAACCCTAATGATCTTTCTCAATTAATTTCTCA
TGGGCTGTGGTGGAACTCAAAAAAATTGCTTATTAATTCCTCTTTACCTCCAAAGAAAAC
AGCTCTGACAATAATGCCTAAAATCACCTTTGCTAAACTGGTTGTGAAGAAGGCTCGCAG
GGAAACGAGCTCCGTCCAGCAGGAAGGAAAGGCTGCATACATTCATCCGACCTGGGCAAG
GTCAGCTGATCTAAGCCCCGGTTCACCCCTGGCCGGTCGGGTAAAGCTCTAATCGCTACC
ACGCAGTGGGAAGCAATGGAGTCTGGCTTTGATACGGTCTGTGTGGCCTGACGGATGCCC
GCGTCTTTGATGGACACAGTGGCGTTGATCGGTTCGCATACGGGCGAGTGGCCATGGCTG
GTAAATGTGGCCGTCCCTCCGTTTTCCCATTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved