Tetraodon_nigroviridis Locus Poly:SNORA70
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Poly:SNORA70
Tetraodon_nigroviridis
Poly:SNORA70
3
SNORD70, SNORD70
1001..1088, 1619..1691
2691
tatacgatccgaattatatttttgcattgttgaaagacatacgctaacttaaagaataa
tgaacaccagaaaaccacttttaacatctaggaatgaatcaagttttttgtacaatgcca
aaaatctgtttgatagtcagtggaactttgaaaacatgtcttttgtcgcgtcctttggct
ggcaggatttggcaacccaggagtttccggctgccactttctgccgcgtgtgtgattcgc
gtccagcagcgtgggactgtagcaaaaccgggagctctcttcttagagggcgattaaatt
cataaaaactatcgacacagctgcaaacatgcttgttttgtttgagaccgctgcgggata
cgcaatattcaaagtatgtatttatcttttccgttccttttgcagtatgtccacactttt
ctgtagcgtgctagctttagctcttgaactagtttatactaatacatgctccattggcgt
agataataataaaaacattagtatgcaaaaagtaatatttcataatatcaaaggtgtaaa
atgacaaatatggaatcgtgtgcgtaaactaagattcgcgtacacgctaggctcgttagc
agttagcaggccccgtaaccacgtgtgcacatttggacttcatcactcgccaacagacgt
gtacaccaaaatatcaccctagttcactgtttaactttagggtcttgcacggatcgtcat
ttttattttctggatacttgcaggttctcgatgagtccaaactgcaacaggtcgacagcc
tgcataaagagtttgaaactcctgaaaaggccaataaagtgtaagtgatgtaaagcaaca
gttcacctttgtgagcaactattaagtgaataataaggagatcagccgaccgttgtaatg
gttgcctttgtgttgtctttaccagtgtgaagctgaagcactttgagaaattccaggaca
caacagaggctttagcaggtaatgacaattaaattaaaataTTCTGTGTGGTCGATGATG
CAGTTATGTGTCTGATTAAAACATGAGGCAGTTCACATTTCTCGTCACTACCACTGAGAC
CACATCACGttagtaggtaaaaagggaaaaaatgattaaggatttccactatgtggtgta
ataagtaatgcagtgtttgtggcatttattgattaatcgttttattcaaattctcagaca
ccctgaacttaaaattttcccactttttgttgaatagctgccactgccctggttgaggga
aaacttggtaagagcttaaagaaagtactcaagaaaatagttgccaaggaagctcatgag
cagctggccatcagtgatgtgaaacttggcggtgttataaaagtaagtgactcaatttgt
tttgttgtttttttatatttttacgtgcagtagccacggataactggttctggttttcag
gaaaagctggacctgagctgtattcacagtccaacagtgtgtgagctgatgagatgcatc
aggagtcaggtggagagtctcatcactggacttccttccagagagatggctgcaatgtct
ctgggacttgctcacaggtaagaacattacctgttacgtgatttgcaacaggaaccagcT
GCCAATGATTACACTTGCTGCCCGAAACATTTGTGTGGATTTATTTCAGCATTCGTCACT
ACCACTGAGGCAttttctgtcccaatttagaaatatcgcacatttgagtgtgaaatcact
caatgacactgacttttttgtgtgtgtgtttgacagtttgtctcgctacaaactgaagtt
tagcccagataaagtggacacaatgatcgttcaggccatttgtaagttattttcctaatg
tttacatccatttattatgtttggtttaagattcaatgaaatccaaagttgtttttgatg
aaataatatttttagaatgtttaaagacaagttacaaaagtacaaagatgggttttcaca
tctaaattaaggcatatttgtccggttttctttatttcctagcccttctagatgacctgg
ataaggagctcaacaactatatcatgccctgcannnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved