Tetraodon_nigroviridis Locus eef1b2
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis eef1b2
Tetraodon_nigroviridis
eef1b2
3
SNORD51
2997..3071
4702
GATGAACGTCGGAGTTGTCTTTACCTCCAATTGGGTCTCATGCTCTTCTGTCCTCCGAC
ATCCCACACTGTCAGAGACGTCTTCTTGTCTAGGTCCAGATTTCCCACATTGAAGCCAAT
GGTTGGAGATGTTTCCATCGCCTTAAAGTTAAAGTTAGGTTCAGACTGAAATCACCTCCT
TTACATGAGAACTGCATAGAAGAATCTCACCTTTCCTGTCAACAGTTGGGCCAGCAGAGT
GGACTTTCCAGCTGAGTCCAGACCCACCATAATCACCTGAACACACAAGTGTGCGTCAAG
ACAGAGAAAATGTTGAACTTGCGTGTGGGATGTACCTGAGGTAAGGGGGAGCTGCCAGAT
TGTCCCATCTCTCCACTTCTCTTTTTTCTTTTTGTAGATCTTTTTCCTCTTTGTCTTTTA
TGTCCTTTTCTGTGCCCTTTTCTTCGACTTGTTTTCCCACTTTTGTTGTATTTTCCTGTC
CTCTATCCTTTTTTTCCTTCTTCTTCTGACATTGTGTTCTTAGCGATCTCACCTGTTTAA
CATAAAGTCACTTGCTGTTTTTCACAAGTGTTCAGGTTCATTCACTCCATCAGCCAATGA
GAGAGCAGTATTTAAATAAAAGCTGTCATGTGACTGTGTGACAGGTCCAACAAGATTTTT
GAGTCTGGTGGAGAAAACCCCTGGAGCACATCAACCAGGATTTTTTTTCTCTTAGACACA
CTGACCATCTCGTCCTCTTGGTCGGACGAGGAGGCCAAAACTCTTGGTCTTGGATCCTAA
CACGTTTCTCCTCTCTATAAATCTTTACTACAACGTTACAACTGTAACAACGTGTCTAGT
CAGTTTAGTTTTAAAGAAAATTCACAATATAAAACACAAATCAGTAAAATTCATGGTTCA
TACTCACCCCCTCCACACCCGGGGGTCCAGGTCCAGGTGCGGGCGTCTTCCCCTCCTTCT
CCTGAGGCCGTGACGTCATCAGGAGGCGTCTCCTCTGCATATAAAAACCATGCGTTCCCG
TCTCCTCCTCCTTGTTCCTCCCGTCGCCTCGTGGAGTGCTCGGTTCTTCCGTCATCATGG
GATTTGGTGACCTGAAATCTGCCTCTGGCCTCAAAGTTCTTAATGATTTTCTGTCGGATC
GAAGCTACATTGAAGGGTGAGTCCAGCTTTGTCACCGGTCGGTTCAGTTCCGGTCCAGCT
GCGCCTCCATCTTGGCTAACTGCTAGCCACATGCATCATGGCGCGTAGGGATTCTGGGGT
GATGAATTGAGCTTCGTGCAACTGCAGAAACTGGCGATAAACTTAAAACCGCCAATAGTA
CAATTAACAGTAGTCAAAATCTTTGTGCTAGGAAGCCGTAAAGTTAGCTGCATACTCCCT
CCGTTAGCTTTGACCTCGTGGTGCTGTGGACCAGCTCTACGTTGCTTTGTACTGCTAGCG
TGATTAGGTAAGCGTTCTGTGAAAGTTGGAGTTGCTGTTCTCATTAATGTGAGACTTTCA
ATTTAAACATCAAATAAAGCTGATTGGAGCTCTTTTCCTATTGTAGACTTTAAATTCAGC
CCCCAACTGCACATGTCCGGTCTCCAGAGGTCCTGGTCAGGAAGAATCCAACGAAGACCA
CCTATGATCGTTGTTGGTTACCAATCTTTGGCACATCTGTGGCTTCTTTCTCCACGACGT
ACATGCAAAAGTGCAAAGTGCCACTTGAAGCGGTTGTATTGTCAAACAGAAAACCTAAAA
GGTGGATAAAAGTGATTGCATGTACGAATGTTAAACTTTTGTAGGCACCCAGTGTGGTGG
CCTCTCGTGATGTAAGTAGTGATGGAGAAACCAAAGCTTTCTGAACAGAATCAATCTGGA
CCAATTGCATTGAAAAGGTTTAGCGTTTCAAAAGATTTGATACAATTGAGTATGGCGACA
TCTGCTGGTCAAATGTGACTCCAGCGACACGCAATAGGGGAAAGGAAAAGACTGTTATGA
ACCGGAGCTACCAGGACAAACCATACTGAGACAGAATGCTGGTAAAGCTGAAAAGGGGAT
TTGAGTGGTTGTTGAGTCCAGGCCTACCTAACAGCTTGGTAGTGTGACATAGTCACCAAA
GCACGGAATTTAAGGGGATAAAGACTAAAGAAGTGTATTGTAAAACTAAGCGATGCAGAG
CTGTTTTACCGATGAACGACTATAAAGATTTTGGTTTAAAAACAAGATAATATCTGTGCA
GTTTGTTTGTCTGATCCTCCCAGACTGAATCCGCTCAGGATTCAAATGGTTGTGATGCGT
CCCTGGTACACCTGTGATGTCATGAAGCTTCATTTCGGCAGTCTGATTTTTTGGGGGTTT
TTTTTTTTTTTTGCAAGACAAAGCAAGGCCTCAAAGCATTCTGTCACAGGCATTGATCAC
CTGTTTCGAGCATAACCTCTCTAGATGAAAGTATTTACTGCAACAGAGTTGGATTGTGAC
TTTGCTTCTGTTCGGTGTCCCATCTCAGGCTGACGTGGTTGTGTTTGATGTCCTCTCATC
GCCCCCACCAGCAGATATGATTCATGCTCTCCGCTGGTACAATCACATCAAGTCCTTCCA
GAAAAGCAGGTGAGGAAAGTGTGATTTTTTTGATTTTGTCACCTGTACCACGTAGATATC
TGGTGCAATGAAGATGTGCTGTATTAGTCTTCCAGGTGTGAAGAAACCTCTGGGTCAGTA
TGGTCCTCCAGGTGTGTCTGACACCACCTCTGCCTCCAAACCTGCTGCAAAGGATGATGA
CGATGACGACATCGACCTGTTTGGCTCAGACGATGAGGTTGGTCTGCAATGGTGGAACGC
CATCCCGTGTGAGTACTGACACTTCCTACTTTAAGGAGGATGAAGAAGCCGCCAGGATAA
AGGAAGAACGCCTGGCACAATATGCTGCAAAAAAAGCCAAGAGTAAGTTATAGATCACTG
ATCACCGGCACTGTCACTTTATTGCCATGACTGAGGTTCCCCTTCCTGTGATGGGCTGAC
TTCCAATGATGATTTATTTTCACCATCTTTCGGCTGACTGCCTGATGGACACTTGTTTAT
CTGAGAGAGTATCAGCTCTCCTGCCACTGGGCCAGCTTGCAGTGCCTCTGTGGTAACCCA
CCAATGTCTTTAGAGCCCACCGTCATCGCCAAATCCTCCATTTTACTGGACGTGAAACCC
TGGGACGATGAGACGGACATGGCAAAGCTGGAGGAGTGTGTCCGCAGTATTCAGATGGAC
GGACTGGTGTGGGGACAGTGTAAGTGCCACAGTAATGTGACAAAATGATGCATGTTGTGC
AGTAGTGATGATCTAACTCACCATCTTTCGGCTGAACTTAAGATGATACTCATAAATCTG
AAATGTTTCAAGGTTTTCTATTTATTTTGGCTTTTTGCGTTTTGGGATTGGTAACTTTTA
TACTTTGTATAGCTAAACTGGTCCCAGTTGGTTACGGTATCAAGAAGCTGCAGATTGGTT
GTGTGGTGGAAGATGACAAGGTGAGTCGGTTCAAACGACACTGGTTATTTGGTGTTTTAA
CACTTCTTTTTTTTTAACATACCTTGTACTCTTTGCCTCTTTAGGTGGGAACTGAAATAT
TGGAAGAACAAATTACAGCCTTTGAAGACTATGTTCAGTCAATGGATGTTGCTGCCTTCA
ACAAGATCTAAAAATGTCACATTAATAAAGCACTTCATCAGAATAATGGCTTTGTTTTTA
AAATGTCTTTGACATTACTGTATAACTAACATGTGTCTGACAAAAAAGTGGTCTTTAACG
TGATTGTACAGGCTTGGTAATATGTCGGTGGACCTATAGATGGCAGCACTTAGGTAGCCA
CATCGAGATCTCCGTCGAAGAAGAGCAAGGCCGGAAGTGAGCGTCGCGCGGCAGAAGAAT
AAATAGGCCAAGTAAACTAGTGGGTTCAGGTAAACTCGAGCGTAAGTACGCCGTTACTGA
GTAACTAAGGGCCCACAGTCTTCCAGTTTGGCAGGATGGACTTACGTACACGCGCCAATA
AAAGCTACCCGTACAATGCTAAGGCTAGTAGCATCCCTGACGAAGTGACACTTGGACCAT
CGGTGGCGTCGCCATAGTTACGAGTTAATTCACTTTTAATTATGTAGACGTTGAAGTAGT
CAATGTGATAACTATATAACCCGTCCTCAGCCAACCAATCAGTGAACCAACAGGTAGTTG
TAAACTATTAAGATGCTTAGATGTTGTCAATTCAATTACTTTTAAATGATGTGTTAAAAA
TTATTCAACAATAATGGGAAATATTTTTGCCTGTTAGTCAGGTCACAATTACTGAATTCA
GTTACGGTATAACCTCCGATTGGGGTGTGTTACCCTGCGTAGCATAGGGTTTTAAATGTT
TAGTAGAAAGAAATGGGATGAATCAGACAAATTTTTGACATGTGCTAAGCTCTGCTACTC
TAATGATTTTTAAAAACCCAAGACGTATTTAAAAATTTACGACTGAAATCTAATCTCTGT
GGATAATACGTGTAATAATACGTCTGTATTTCCCATATTTTCCGAAATCATGTGACCTGG
TTAGCGCGCTAACAGCTGTTAGCCTTCAAATAAACAGCGACCAAACACGGTCAGACTGCA
CCAAAGATCACATTTGGGTTAATTCGCAGATCTTTAAAGCTGTAGATTACTGTAACGCCA
TATCATCTCTTTGTGGCAGAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1157, 1546..1746, 2474..2588, 2667..2796, 2855..2921, 3133..3258, 3432..3499, 3584..3702
1076..1157, 1546..1746, 2474..2588, 2667..2796, 2855..2921, 3133..3258, 3432..3499, 3584..3670
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved