Tetraodon_nigroviridis Locus rpl3
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rpl3
Tetraodon_nigroviridis
rpl3
3
snoU83B, SNORA54
2706..2798, 3823..3953
5109
TTGTTGGCTCACCTTTGTGAATTCTTCCTCAGGGTTCATGCCCAGAGTGATCAAAGTGG
CCCCGGCCTGCGCCATCATGATCAGCACCTACGAGTTTGGAAAGTCCTTCTTCCGGAGGA
TGAACTTGGACAGAGAGTGAGCAGCAACAGGAACCTCGTCGCACAAACCTGCACAGAATA
ATGTGAAACGTTATTGGATCAAGTCCAGACAGCCTTCACGCTAAAGGGGAAGTGAGCTAA
ATCCCTTCTCCAGAAAGATACTTCCTACTGGCACATTTTGTTGGCTAAGCTCAACTTTTC
TCAGAAAAACCAGAAAAGCATGATAAGACTGCTGACCAACCCCTTTCTCAGCTACTCTCG
ATTTCCTTCTTTGAGTCCCACTTTAGTGCTAAAACAGAAGGGTGGGTTCTTTATAACAGA
GTGTGCTTAGTTGCTGTTGACTGCAGCAACATTTAAGTTGAGTCTAAGTAAAACTTTATG
GAGGAAGTTTGAAGCAAATTATCTGTTACCTTTCCAAGAACTGATTTATATTTCAAAGAA
ATGTACTGTGAAGACAATTTTGATGATCTGGTGTTAGGATGAATTTCTTTTTCTGTTACT
GGCTCATAAAACTATTGTAATGCCTTAATCTGGCAGGTTAAGTGTATGTCTTTTGTCATG
CCAGATTTATTTCTTTTCTTAGTGACGGCACTTCCTTAAAATGTCATTAAAATCTGTTTA
TAACATCGAGTCCTGAGGTTTTTTTTTAATGGAATAAATATTTATTAACAATTAAGTTTA
TTTTTTGTTGTGTTTCAAATTAAATTCACAAAACAAATTACCTCTCTATTCAAAGGTTTA
AATTTTTTAGAATGAAAGTCTAAATGTTTTTTTTTTAATAAATATATAATTTGGGTGTCG
TTTGCCGAAACTGCGGCACATGGCAACTACTGACGTATTTCCGGTACGACAAAAGTCTCG
CAGAATCCCGCGATATTTCGAGCGTATATATAACTTTTTTTCCTGCCTTTGGGCCTCTTT
GAATCGGACCAGAGACAAGATGGTGAGTGAGCGGTCGATCCAAGAGGCAATCTAGTCGTC
ATCTACGACATCCTGTGACTTTTAATTAATTTATTTACTAATGTTACGTCTATATTTGAC
ATATATGTTTAATAGATGGCTCGTTTACATATTGCCGTTTCCAGTAGGGTATTTCACTTA
TGGATGGCGGCGTGTAGAAGGTTCAACATGGCAGTTCTACTGCGGCCTTTAACGTTTAAC
TTGTATACTTATTTGAATATAGCTGTGTTACCTCTGTGTAATAACATGTGCAAAACGGTT
TCTTCATAATGCGTATAACAACTGTTGGATTTAAAAGTACGAGGTTAGACACTGACTTGT
CTGCCAGTGCGGCTAAGCTAACATCGCGGCTAACTTGTGCCAACGATGAAAGAGTCTCGG
CACCATTTCTCATAAATTGCAAAGAAATGTAAAGCACTTAAGATATAACAAGATGTTAAA
TTTTGTCTTCTTTTCTTACAAAGGATATTATATAAATCAAAGTGCATTTTAAATGCATTG
ATCTGAAAGGCAGTATAAAACTTTAGCGCCAGTAATTTTACAGTTTTAGCGTCATTAGTG
CGATAGGTCTTCATTTTGGCCGTTTGCTAACACATCTCCCGCGTTTTCGCAGTCTCACCG
CAAGTTTTCGGCTCCACGCCACGGATCTTTGGGGTTCCTGCCCCGCAAGAGGAGTCGTCG
TCACCGCGGGAAGGCCAAGAGCTTCCCCAAGGACGACCCCAGCAAGCCCGTGCACATGAC
GGCTTTTCTGGGCTACAAGGCCGGCATGACGCACATCGTCCGTGAGGTGGACAGACCTGG
CTCAAGTGAGTGGTAACAACAAAAGTTAAAGCGGCGCCAGGGATGAGAACTGGTGGTGAC
GGCGTGCCTGTGATGAGACCCTCGACGGGCGGACATAGTGGCTCTACAGCCCCTTTGCTG
AATGTCGAGTACTGAGCCACAGCCGGTCAAATGTCGGCGCTTGAGCGTCTTTTTTACCGT
ATCTTCATCTGACCGAATGTTTGTTTTCAGAGGTGAACAAGAAGGAGGTGGTGGAGGCCG
TCACCATCGTGGAGACTCCTCCCATGATTGTGATTGGCGTGGTGGGCTACGTCAACACGC
CCAGCGGTCTGCGCTCCTTCAAGACCATCTTTGCTGAGCACATCAGTGACGAGTGCAAAC
GCCGCTTCTACAAGAACTGGTGAGTCGGCAGGATTGGAAGCTGGCGGCTCCACAGAAACG
CCGTTCCCACACAGCCTAACGCCGCGGCGGCCTCCGGCAGCTCCGCTCAGGCGCCGCGCG
CCCTGATGAGCTCCGGGCTCCTCTGGCCAGTGGAAAGTGCGTCTTAGAAACTGCGCCATG
AGCCAAAATCTCCAGGCTGACGCGCTCCCCTCGTGTGAGGAGGATGAGCAGCCGTGCACT
GCGTCCTTTCGCTGGCCCCAGGCTATGAAGGACCTGTGCCAACTGTTTCCGCTTCCTCTG
CTACATGCTAACAGGTACAAGTCCAAGAAGAAGGCGTTCACCAAATACTGTAAGAAATGG
CAGGACGACGAGGGCAAGAAGCAGCTGGAGAAGGACTTTGCCCTGATGAAGAAGTACTGT
CAGGTCATCCGTGTCATCACCCACACACAGGTTAGCGTGCTGGTTAGCTTCCCTATCTGC
TCGCCGCTCCGTCTGCGATGAGACCACGGATCTGGCGCCGGGCACGGCGCCCGACACTCA
TGAGGAAACCTTCCATGCTGCCTTCCTTCTGAGACGGACGCCGCCCGGCGTCTGAGCGTC
CGCACGAGTGCTTGTGTCTGAGCGTCTCCGTCTCTGCAGATGCGCCTGCTGCCCATCAGG
CAGAAGAAGTCCCACCTGATGGAGGTGCAGCTCAACGGCGGCACCATCGCCGACAAGGTG
GACTGGGCCCGCGAGAAGCTGGAGCAGTCCATCCCCGTCAACACGGTCTTCGCCCAGGAC
GAGATGATCGACGTCATCGGCGTCACCAAGGGTCACGGCTACAAGGGTGAGTGAGAAGAA
GGCGCTGTGGGCCGGATGAAGTAGTTCACCGGACCACATGTGGCCCGCGAGCCTCGGTTT
GCCCTCTTTGTTAAAAGGAGACGTCTTCTGTCCTAGGCGTCACCAGCCGTTGGCACACCA
AGAAGCTGCCTCGCAAAACACATCGTGGTCTGCGCAAGGTGGCCTGCATCGGTGCCTGGC
ACCCGGCACGCGTGGCCTTCTCCGTGGCCCGCGCCGGCCAGAAAGGCTACCACCACCGCA
CGGAGATCAACAAGAAGATCTACAAGATCGGCCAGGGCTACCACACCAAGGACGGCAAGG
TGGTGAAGAACAACGCCTCCACTGACTACGACCTCTCCAACAAGAGCATCAACCCCCTGG
TGAGTGGCGCACGCTCCCGACGCCGGCGCCGGCGCCAAGCCGCAGCCGCCTGAAGCTCCT
CGTGTGTCTGCCAGGGCGGGTTCGTCCACTACGGAGAGGTGACCAACGACTTCGTCATGT
TGAAGGGATGCGTGGTGGGAACCAAGAAGAGGGTTCTGACCCTGCGCAAGGTTAGGCCTG
GTCCAGGCGGAGTCGACCTGCTTTGCTTGTGGTTCTGGTCCAACCCGTGTGTGTTTGCAG
TCTCTGCTGGTTCAGACCAGCCGTCGCGCTCAGGAGAAGATCGACCTCAAATTCATCGAC
ACCACCTCCAAGTTTGGTCACGGACGCTTCCAGACCGTCGAGGAGAAGAAGGCCTTCATG
GTACAGCCCCGGCCCGGCCAGCAGGCGTTTGGTCGCCGTGACGCTGCACCGTTCGTAACC
TGGTTCAGGTTCCGTGTGAACTCGGGTTCCATTCCGGTGCTAGAGCAGCTCCGGTGAGGC
AGGGGGGCGGCGCCCTCCTGCGCCCTGCTCCCCGTTCACTCTCCGGGAACACCGGCTCCA
CAGCCTCCGCGAGCCTGCTCTAAGCCACGGTTCTGTCCCACAGGGCCCGCTCAAGAAGGA
CCGCCTGGCCAAGGAGGAGACGGCCTGAGGAGGCGGAGCCGAGAGCCTCGCCACGCTTCA
GCTCGCTTTAATAAAGTGGAACGCCACAAACTGTGTCCTGGATTCAATCCTGAGATCTGG
ACCCGTCAGGGTGATGCTCTGAGAACAGTTAAAAGCTTAGTCAGCTGACCTGGATCCAGC
TGTGGCTCCAAGGGGGAGGGGCTTATGCCTGTAGCGCCGGTTAGCCAGCGGCGGTTTGTA
GACGTGTGAAGTTGTCCACCTGGCTCCAGAGGAAGCAGCTGCTGCTGGAGGGACAGAGGC
CAGGTTAGCAGGCTGTTATCAGCAGGGACGCGCGCGCGCGTCACACACTCACACACACAC
ACACACACACACACTCACTCACTCACTCACTCACTCCTAAATGTTCCAACAGCGCAGGGT
CCTTCAGATGAAACTTAGCGATGGACGGTGGTTGAAGTCACCTGACTGCAGACCCCGGCT
GGGTTCGACCAATCACATTTGCTAAATTAACATTTAATTAACAACGGCCTGATCAGGTGA
CTTCTCCTGCGGCGCCGCCAGGGGGCGCCGCGAGCGTGGGTCTGATTCGTACAGCCGCAC
AGGTGAGTCACCTGTTCCGGCTGAAGCTCAACAGACCGGAAACCACCCGGCAGCAAACCC
CCACACAGCAAATTTTATAATTTGATCAATTTTTCGCTTTTCATCGGAGGAGTGAGGAAG
CCCCGCCCCCTCCGCTCCCAGTCCAGCCAGTTATGTCATCTTGCCCCCCCCACCCCTGAT
CACATGACACCCAGATGAGCAAAAGCAGCAATTTCCTCAAAATGAATAAACAAAAGTTGC
ACAAATACCTTTGTCCTGACGGAAATGTTAACACTAAAAACCAACTTTTTCTGGTTTCAT
TTTTGAATCGTTGATAATTCGGTATCAGTCAAATTTCCTGGGGATGGCAGAAACTGAGTG
TACCGGGAATTTGTGGGCGGGGCTAAACCGCTAACACCGTTACCGGGATGCTGGAACTCC
CACCGGATGAGATGAAGAAGTACTTGACTAACCTTTCATAGAGACATCTGCTGAGGAGGA
GGAGGAGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1041, 1672..1864, 2070..2238, 2534..2669, 2859..3045, 3156..3418, 3494..3589, 3660..3779, 4003..4109
1039..1041, 1672..1864, 2070..2238, 2534..2669, 2859..3045, 3156..3418, 3494..3589, 3660..3779, 4003..4047
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved