Tetraodon_nigroviridis Locus Poly:SNORD88
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Poly:SNORD88
Tetraodon_nigroviridis
Poly:SNORD88
3
SNORD88, SNORD88, SNORD88
1001..1092, 1286..1377, 1585..1676
2676
ACAAAACTGTTTCCCGTCTACCTTTCAAAATAACGCGTGTCATGACGAGATGGGGATAT
GACAGATTTCTTTATCCTAATTACAACGAAGAATTACGCATCAAAGGTAGAGTAACGACA
TTGAATGAGCAACAAAATATTCTTCAAAAATGGGACCGTGGTGTGGGTTAACTTGTTTAA
CGAGCATGTTTATTTGCTTTATTTTACGTGTCGATGCCGGCTTTAGTTCTGTCCGGCTAC
TTTAAAAGTTCTGCTTTCTTTCCGGCTGTAGTGACACAATGTAACCACCAGGTGGCAGAA
ACGGGGCGTTTACTTCATTTTAATGGCGTTTCTACAGGTATGAGAATCAAAAACGAAGTA
GAGGAGAAGTGGATTAGGTTACCCTGGATAACGCACAATCAGTCACATTAGAGTGCAGTA
GAAACGGTCGTATTGAACAAACCCGGCATTTACGTGATGCAATTCCACCCCGGGCCAGCA
GGAGGAGGTGCGGCGCGTTTGCGCTGACACACAGTCATCAATAGTCAACGCGAAGAAGAA
GAACTCGCTGCGGTCATTGCAGAAAATGCAGCATGGGGAGAGGTGCAGCTCTAACTTCTG
CGAAATTCCATTTTCCACTCCTTTACAGTCCGGGTGATTAGGTTAACTTCAAAACGGACT
TATGAAACCGTAATAGAAGCCTTTGCAGCGCAAATGTTAAACGACGACGGTCAAAATGTA
CGTATACTTTTACTCTGTTACTGCCAGTATCGGGACTTATCAGTGGTTAAGATAGTCGTA
TTTTTTAATCGTCTATTTTAAGTAAACTACACGTCTAGGGAGCAAACATTTTTAATCGTT
CACTTGACGAAAGGCCGTCATCACGTGGGCCTTCCTCCACGTGGTTGAAGCTAGCTTTAT
TAGCACGTTAGCTAACAGAGTGTAGCCAAACGTGAGATAAAACCTTCTGTAAGCTCCCGG
TGGTGGCTGGCTGTTCTGATGCCGTTTAGGGGACTAGATCTGCTCTCCGTTGATGACGCG
CACTGGGCTCTGAGTCCACGTGGAGACAAACGTGCACGTCTGGCCCTGACAAGCCGGAGC
TTCTGAGGAGAAACTAACTTGTTGGGTTTTGTTTTGAGTTCACAGACTTTTCTGACTTCA
GCCTTTGTCTTTTCAGGCCGCTGCAGACCCGCCGGAGTCTGGGACCAGAAAGGTGAGAAG
GTCACCCAGAACTGGGTCAGGACGCAGATGTTGGCAGTGTTTGCATCTTCCGGTCAAGAA
CTTCCATGATTGCTTCACACGTGTTGGCTCTCCCATGATGACGTGCACTGGGCTCTGAGT
CCACGTGGAGACGAGCGTGCATGTCTGGCCCTGACAAGCCAGATCTTCTGAGGAGAGCTA
GAATCATTTAGCTTATATGACAAAAGGTGTGTGAGGGGGTCTAACCCTAACCCTGTTTCT
CTGCAGGTCACCGACCGGTGGAACCGAGCGGCCTCTGGCCCGTCGCTGTGAAGGTGTGTA
AATCCTCGTTGATCGCTTCCTGCGTGTTAATCCGCGATGGCTACCTAGCATCTGTTTGCT
CCAAACTCACCGGTGGCGCTACACTGCGCTCCCATGATGACGTGCACTGGGCTCCGAGTC
AGCGTGGGGACAAAAGTGCATCTCTGGCCCTGACAAGCCAGAGCTTCTGAGGAGAAAGTG
GCCTGATTTTGACCAAAAATGAGAATCGGAATGAACGCGGGGCCTGGATTTTGTTGACAT
TCGGTCGGTTGCGGCTGTAACTTTTCTCACCTTTCAGGAACGCAGCTGCTGGGTCACGGC
AGGTGGAAGGAGAAGGTGCTCGATGCCGCCGGGTGGCCTGGAGGACATCGGAGCTGCTGA
TCCGAAGGCTGTTCAGCTCCACCTGCAGATGGAGACTCGTTTCCAACATCAGGGCTCAGG
TTTCCAAACTGGCCTCATTCCTTTTGGAATTTGTTACGAGGACCAATAAAGATTTTTCTC
TACACTTGACGCCAACGTTTGTTTTCTTTAATGGTGTTTCAATACTGTCTAAACCCCCTT
TTTATACCTGCGGTTCAAAAACCTGGAAAAAAAAGATGCACAAGCAAGTTTTAAACTCTA
GAACTTTGTTTCTTTATTATAATTCTAACAATGTCTCTTAAAACATTTGAAATTCATATA
TATTTATATGAATGTGCGTATATGCATTTCACATATACATAAATATTCTGCAAGTGACCT
TTCATCAACTCATATTCTCTTTAAAGATCTCTGAAACAGGAAAAAAAAAACCTCTAGAGT
CGGACCGGTTCCCTCACGTCTGCCAGCGAAGCGTCGCTGAAACCGGAACGGATCCGAAGT
GATTCCCTGGAATCTGGGCGTCTGTATTTACACTCCCTCCAGGCTGGACCTGATAGAAGC
AGGGTGAGGCTGCGGGTTGACCTTCGCCGGTTTCTCCGCTGCGCAACCTCCCGACGGCCC
CGAGGAAACGGTGACGCAACCGCAGCCGCGGATGGAAACGGTGGTTGCATAAAATGCTGG
TAATAAACAATGTGCAGCGGCGGCACCGACGCGTCAGCGGCTGCAGAAGGTGCTTTGTAC
AAAGAAGCCGCGGATGGCGAGCAGAAGCGGGCTGGCCGGCGGTGTAGAAAGAGCCGTTAA
ATAAACACGCGAACCCTCTCCTGATTAACGTCTGGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved