Tetraodon_nigroviridis Locus si:dkey-159f12.2
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis si:dkey-159f12.2
Tetraodon_nigroviridis
si:dkey-159f12.2
3
SNORD35, SNORD35, SNORD35
1728..1810, 2132..2214, 2545..2626
3820
TCGTTAAAACAACTGCAAATTGGGTAGTATATACTCACTCTTTTAACAAAAGACAGCCA
ACTTCCAGTACCTGATCGTTTGAATTTCCTGGAAAATAAGAGTATAAAATGTCATTACTC
AATCACCGAATACAGTTTGCCTTCATTTTGATTTATAACAGACACATCTTGCGTTTAAGT
TAAATGAGTCATATCTTTTCCGTGAAACTACTGAAAGTACATACTGGTCTGCCTGAATAT
GTATATACACGTAGATCTACACACAAAACTACTTGGTTGAGAAATTATCGTATTTAATTT
GGTATACTATCGCTTCAGTTAGCACAAACACTAAAGTTAGGAAGAGCTATTGGGCTAATT
ACGAGTCCTTAGGGTTGGAGCGCTAACCACTTGCTAACATAAAGCTAACGTTAGCTATCT
TTTCAACCTAATTTCTGATGTTACTACTCAAAAGTAAACCCGTTAAAGGCATTTTGAAAC
ACGGTACTTGGTAAACTTATTAGAGAACCTATGTACATAAGGCCTGTGGCGACAATGACA
CAACATTTTGTGTGTTTAATATTATAATGTTAGCCCAAACCTTGATCGCCTCCTCCTGGG
TGCGATGCCATCTTGTTGTTTGCTATTGCTTCCGGACAATCATGTGACAAAACTGTTTTA
ATAAAATAAATGTTTGCGTTGCTCCTTTGGCCGCCGACGCCTATATGTGTCCAGATAGGC
TGTCTGACTGCACTAGTATGAACATAAAGCCAAAACAAGTGGTAGTGACATCATCAAGCA
CTGACTACGTTGCCTTGACGTGACGCTCACTAAGGATCTTTCACAAAGTTAATTGTACTG
TGGCGCTTATCTAAGGAAAAAAAAATAATATGCCATGTTCAGATATTAGACATTGCTTTC
GAGTGAAAAATATATTTTTAAGTTGTTTTTCAAAAGCCTCGCCTTTTAGTCGTCATTTCC
GATTACTAGTGGTTTTCCGGTCGTCGTGCTCGTTCGAAGGCCTCTTTACGACTCGGCTGG
CAAAGATGGCGGATGCACAAGTACGTCAAAGAAAGCGGCGTGGTGTATTTAAATCGACGT
TTTAACATTTTAATAAATACATTTCTTTCTATATATCGCAATTATGATTTTATGTTTTGG
TTGTACGTTGTCACGGGCGGATTCGGTGCGCCTAAATGCTTTTTTTCGTGACTTAAGTTG
TTGCACTCGTATCTTCCTCGTGTACCGATAAGCTAACTCGAATGCTAACACTGTTAGCTA
GGTTTGGATCAAGAGAATTTACCTAAAATGGCCATTAAACTGGGAGCAACATAACTGCTG
CAAGTCTAACGACTTACATTTCTTTATCGTCGTAACCACGAGTCGACAATTCAATGTTTA
ATTTAGAATAAGACAATTTGCAACGTGCTTTCTCGGCCGTGTCAGGATGTCCCTATGAAG
GGTGTCAACGCTGATTCTTAAAAACTTCCATAACATCATGATTTTTCTGTTTTGCAGACC
GAGCGGTCTTACCAGAAACAGCCCACCATATTCCAGAACAAGAAGCGTGTTCTGGCAACC
GATGGTGGCAAAGAAACCAAGGAAAAGCTCCCCCGGTACCACAAGAGTGTCGGTCTGGGC
TTCAAGACCCCAAGAGAGGTGAAAATGAAGCTCCACTCTTTATACTGCCGAATAGTTTGC
ACTGGTTTAGCTGTGTCCCACATCCATATAGCTATACAGTACTTAATCTGCAAATGATGT
CTTTCTCACGATGGTCTTCCTAACCGTAGGGTTCTGACGACACCGCCTAACGGCAACACT
GATGCAGTCGGTGTTCGGAAGATTGACACAATCTGCAGCTGTGCGACGTTGACATGTTAA
CCTTTGCTTTCCCCAGGCTATCGAAGGCACTTACATTGACAAGAAATGCCCCTTCACTGG
AAATGTCTCCATTCGTGGCCGTATCCTCTCTGGTCAGTTTAACTCTACGGTGATTCTCCA
TCGATTGGTTCCCATCTCAGTATCAGCCCTACTTTAGCTCGACCAATGCAACTCTCAATT
GTTGCTAGTCGTGCGTTTAATTAAACATTACATGGCTGTAGACCAAAACCCACTATAACT
GTTTAGATTTCTGTTATTCCTTGTCACTACCCTGCAAATGATGTTTTATCACGATGGTCT
TCCAAACCCTCGGGGTTCTGAGGATACTGCCTCATGGCAATACTGATGTAGTAAAGTGAC
AGCCGTTGATGCAGATCTGTGCGATTGAAGCTTCAACGTGAGTTGATGCAGACTGATGTT
GGCCTGCAGGTGTGGTGACCAAAATGAAGATGCAGAGAACGATTGTGATCAGACGCGACT
ACCTGCATTACATCCGCAAGTACAACCGCTTTGAGAAGAGGCACAAGAACATGTCTGTCC
ACCTTTCACCTTGCTTCAGGTAATCGCCCGTTCAAATGACACACTATGGTGTATTACAGA
CGCAGTGTTTTAGAGATGGCGGCATGATCAAGGAGGATTTTTGGGATTCTGTGATTTGGT
TTTGGTAGATTAGGATTTAATTGGCTGCAAGTGATGTCTTTCTCACGATGGTCTTCCAAG
CTCGATGCTCTGACGACACTGCCTTTGGCAGACTCTGATGCAGCTTCGTGCCTTAAACAT
TGTCCTGGTCGGGAGCTACGCTGTCCCGCTCACTGAACACGCTGTTTGCTTCCGCAGAGA
CGTCACCGTTGGCGACATCGTGACTGTTGGAGAGTGCCGACCGCTCAGCAAAACTGTGAG
GTTCAACGTGCTCAAAGTGACAAAAGCTGCTGGAGCCAAGAAGCAGTTCCAGAAGTTTTA
GATGTCTTTGACCAGGAAAGCTACATTTGGCTGACTTGATTCATTGGCAAATAAAGAAAT
GTTGTTTAAATTGCCCTTTTGTTCTGATTGATTTGGAACTTTTCTTGGTAAATGTGATTG
TTTTTTTTAAATTTGTCAGACGCCAGAAAATCCAACCACTTCAAGATTTGACTTCGGTCG
TCCCAGTGAAACTATCAGAATGGAAGAAACGTTTAGAACGCCTGACATCCTCTTAAATTA
GAGAAGTTATTGAATTGGATACAGATTAATTGTTCATTTACAGAAACCTCACACCCAGCA
ATGTCTCCAGAAACCCCAGATGCTGAATTAAAGAAGAGAAAGACTTGATAATCTAATTTA
CTCACCCGCTCTCTCAGACTGAACTGTAGAAGCGGTTTGGATGTTGTTCTAAACGCGTCC
AGCAGGCGGCGCCAGAGACCCAAAAAGGAACCAACATGGAGGCCGAGCTGCGCCTCCTGC
GTGCTCAGGGTCCCAGCAGATGTGAGCCTGCAGATGTTTTTAAACGAGAGGTGGACAAGA
TAATGCCTCCTGTAAGCTCAGAAATGAAAGCAGTTGCAAAATTGAATGATTAGTTAGGTT
AAAATAAGCCTGAAGCATTGTTTACATGTAAACGTTTTCCTAAGGGGGTTTTGAGTTTCT
TCTTCTGCCGTAGCAACAGCAACCCAGGCTTTATACCACCCATTTTGCAATATTTACCTC
AACAGCTTCAAATTGCCTTCCTTGGGGTTTTCCCAGCTCTCTCTGCCCATGGAGGCAGCA
GACTCCACTGGGGGGGAGGGAGGGTAGGACGTTCCCTGAATAACAGCCCCTCAGATGAGC
AGACACCCTGGGGAGCCGGGCCGCCCAGCAGGCCGCCCGGCCCACGTGAGCACAAATACA
TTCTCTCAGAGAGGGTTAGTCTGAGGGCAGAGGTCTGAGCCCTCCAAAAGCCAGAGCAGC
CATAACAAACCCAGTGTTAAACTGCGAGGGGTCGTGTTGGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 1497..1637, 1876..1951, 2289..2418, 2694..2820
1025..1039, 1497..1637, 1876..1951, 2289..2418, 2694..2820
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved