Tetraodon_nigroviridis Locus rsl1d1
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rsl1d1
Tetraodon_nigroviridis
rsl1d1
1
SNORA55
2184..2315
4529
CTTTTCCCAGGGAAAACCATCGCTATCGGCAAGGTGCTGAAGCTGGTACCAGAAAAGGA
CTAAATGCTGCAACGGCAGCCTGCATGAAGTTCTTTGATTGACTCCAGAAGAGAAATGCT
GCTAGAGAGGCGACCTAAAACAGCGTCTCTCTCTTTAAACCCAACTATGCTGAAGAGGAG
AACACAGAAAATAAAGGACGGAGACGAAACAAGCGTCAGAAGAAGCTGGCGAGACTGAAT
TTGTTTTTTTGTACCATGAAGTGGGAGACCAGTCCAGTGTGTCAGCTTTCTCATATTGAG
AGCTCAGCTATGCCACTAATGTAGCTACTTGTTGCCCTTCCAGTCCCACCCCGGCGAACG
GCGGGCCAACAGAGGCGGATGCAGTGTTGAAGAGACATGAGGAAAAAATGTTAACGCTAA
CATTCTGCAGAAGACGGGGGTTAAAATGCAGTTCATCTCCTTTTTCCAGAGCGAAATTAA
GAATCCGGTGGACATTTTATTTGGTTTCTAATAAATGCGGTACCAAAATGTCAAGCTTGG
TCTCACACTTCCCAGATGAGCAATGGACTAAGTCACAAACTGACACATGTGGCTATTACA
CGATCTAAAGTGAAAATAAAACATCATGCTACAAGAGAAAGGTGTATTTGGTTTGTCTGG
TTACTATCCAGTTTATCAATAATGTTAACAGTAGGACATTAAAGTTTATAAAACTTTGCT
ATTACATGTTTTCACAAATATTAATGTGATAAGTAAGGTAGGTTTAATAATAATGTCTTA
TGTAAATACATTTGCGTGTAGGAGACACCGAGATTTATGCTTAGTTTGATTAGAACATTT
TTTGGGAAACAATTGTAGTCCGAATGGAGAATCCGTGCAAGTTGGCAAGTTTTCCACAAG
GGGGCAATAACGCAGCATAAAAGGTGACATTAAACACCAAAGAAGAAGAAGCCTCAGACT
GCGCACGCGTGACTGGTGTGCACGTGAAGCAGGCGGCATGGGCGGAAAAGACTCAGGTCG
AGTTAGACCTGGCACAGGTACGGAAAATACCTCTGTTTTGCTTCATCAAGGATCCATTGA
GCTATTTTGTATGTTAGAACGATGGAAGGCTTAAAAAATAACTATTCTACTTGCATCCAG
AGCAGCTGGCATTTGCTCATTTGTTTGCTCAACGGTTTAACAGCGAGGCTAACAAGTAAT
AGCCTGAATAATTCGATGATGACTGATACTACGATACTGCATCTATGATATCTATACCAA
ATAATAGGTTCCGTGTTTTTTTTTTTTGTTAGGTCAAAAAGGCCGTTCAGGCCTTACAGG
CTTTCATGAAGAGCCAAACCAAGTCGAGCCGTCAGCCTCTGCTTTCGGACGACAGCCAGC
AGCTGGGCCTGCTCTTCACCCTCTGGAGGGTCCCCAGACAGTCCCAGACCATCCGCATGT
GGGTCCAGCAGGCAGGGCCCCTAGGCTCCCTCTGACCCTCCCCGCCTGAATCTCCTCACC
CTTTCTCCTCCAGACCTCTGCCCCATAAGCATCGGAGCGACACCGATGAGGTGTGCCTGT
TCACCCGGGACGAGCCGCAGATGAGCCCCGAGCAAACCCAGAGGTTTTATAAAAGGTTGC
TGCAGGAGAAAGGAGTCAAAAATATCACCGAGGTGCAGTCTTGAGTGCAGCGTGAATGAA
GTCACTAGTTGTATCTCAGTAGCAATTTGAATAACCTCATGTTTCTTTTTCTCCTTCACT
TCTGTGCAGATCATCCCGTACAAAGTCCTGAAGACGGAGTACAAACCGTTCGAAGCCAAA
CGCCGTCTTCTCGGCAACTTCGACATGTTCCTTTCAGATGACCGCATCCGCCGCCTGCTG
CCGTCTCATCTTGGTAAACATTTCTACGACAGGAAAAAGTACGTTTTTGCATTTTAGCCT
TTGAAAGCCAACCTAGATGCACCTGTTTCAAGCTGTGGGTTGGTGTGATGCTGCTGTGCA
TTTATTCTCCCCACTGTTTTGTTAATGCTTTTACCAGAGAGCCACTGTGTGTGAACCTGC
AGAGCAAAAACGTGGCCAGAGAGGTGGAGCGCCTGGTCCAGGGCACCAGTTTGAAGGTTA
CCAAGAAGGGCTGCTGCTGGTGAGATCAAGTCTACTCTTCATCCTACTCCTGATGGAAAG
CTGTCGTTACCACGATTAGTAACTGCACCTCTCAGCAACCCAGTGGACTCTGCTGAGTGG
TCAGATTGGGTATCAGATGGTGCTAGAACGACTCACTGTGTATCCAGATGGACCTCCCCC
CTCTGTGGAGCCTGTCTCTACAACTTTGAAACATTAGAATGTTGGGAAATGTGCATTTAG
GTGCTTGTGCGTGCACTCGGCCCTGTTTGACGCGGCCGTCCTGTCCTGTCCTGTCCTGTA
GCATGGCCCGAGTTGGCCACTCTGGCATGACGGCAGACGAGGTGACCGAAAACGTGGAAG
CAGCCGTCAAGACTGTAATGGAGAAAATCCGTATGGTGAGTGTGGAGGAGCAGAGTGGCG
CGTCGTCCGTGCCTCCCTGTCCGCCGCTGGTGCACGCCGTTGTCTGACCCGGTTCCCTCT
GGAACACTGTTAACAGAAGGGACCAGTGATGAAGGTCATCCACATCAAGAGCCAGGAGTC
GGTGGCTCTGCCCATCTACAACTCAGGGCTGAGCCACCTCTATCAACCAGAGGAGGAGAA
ACCGGCAAAAGCCCCCCGCAAAAAACAGGTAAGCCTGCGCTTCCTCAGGTTCAACGCTGG
AGATAGTTAGGTAGGTTCATTAAATAAAGAGAGGGATCCAACTGAAGGGTTACTGGCCAG
GCCAGCCTGACGGAGCCGCTGCTCGGCTTGGTCGAGATAAGCAACTGAGAAGTTTAACGT
GGAACCAAAAGCACCAGCCGTCACTCAAGTGTATCAGCAGTTAGTGAGGCTTGAACTAGA
CTGAGTTTCTGAAGCCTGGATATCGATGAGCTTCACTAAACGTTGATATTTACATCTCGA
AGTAAGAAAGACGGATGTCTCATAACAACGGTGTTTTTAGGCAACGGAGACCAAAGAGGA
AGTAAAGGAGGAACCGGCAGATGTAAAGCAGAAAGAGAACACGCAAGAGGAAGATGAGGA
GGAAGAAATTCCACAGCTGGTTCCCATGGCAACACCCAGTAAGAAGCCCAAACTGATGGT
CAGTGATATCGCCAACGTACTCTCAGAATAATCAAAACGATCTTAGGAGAAATCTGCTGT
TTGACCCACCTTTGTTTCTTTTCTTCTTTCTGTTTCTTAAAACGTAGAAATCGTCCAAGA
AAGGGCAGCTGGAGAAAGCCCCCAGAGCCCCCGTGAGGAAGCAGACGTCGAAAGCACCCA
ACAGACAGACTAAAAAGGCCAGCAAGGCCGACACTAAAGTCAGAAGAAAAGTGCCTAAAG
TGAAATGATTCCCCCCACGCGGACGCCTCCCACACGCCTCTGAGAACCGCTGATGTTTTA
GCCTGTGTCCCTCCGGGGAGATTAAACCTGAGTAGAACCCTTCTCGGGAACCATCCGCCC
ATGTCTTTTTTTCCCCTGAAAGCTTTCAAAGGCAGAAAGGCAGCGTGCACCACTGAGCCA
CGACATTAAACCCAGCGAACCTCCTCACCAAGAGAAGGTTCGCTGGGTTTAATGACAAAC
GGCGCCGCAAAAGTACGACTCCGCCCCAGTTCAGCCCCAGTTCAGCCCCAGTTCAGCCCC
AGTTCAGCCCCTCTACGCGCCTATTTAATGGACCATTGAAGTGTAGTGATAAAATGGGAC
TTTGCTACTAAAACTGGTGAAAAATCCACCTTTGGCTGTCAGAGGGAACAGGACTAGATG
GAGCCTCCACCCAGGTTTCAGCGCGGCCCTGAGCGCGTCGGCTGGATGGTGTGACGGGTC
TGTGGAGGCCGCTGGAGCAGGGTCGGCTCCTGGTGGGGCCGCCGGGCTGCTTCAGGACCC
CCCCAGGCTGGGCCAGCCTCCACAGGGCCGTCACAGCGGTGGCTGCTGCTGCGGCGGCGG
GTGGGTGTGATGGAGGCGTCGGCCCTGTGGCCTCGTGCCGACGGGGGCTGAGGGTGGGGC
TGACGGGCCCGGTGTGGATCCTGAGGAGGGAACGACTCGGAGAAAATCGGGAAAATGGCT
CCCGATGGAAAAGAATCACGTAGCAACTGGACAAAATGACTATTTACGTCATTTTTAATA
GCTCCGTCCTGCTTAAATTAGGTGAGCAAACAATTTCAGGAATAGAACTAATAGAATAGA
ACTTTATTCATCCCACAACGGGGAAAATCCACTGTTCCAGCAGCATGAACATTGGAGAAA
ACAAATTTGAAATATAAAAGAAGACAAATAAAAAATCTTTTTGCTGGAGTCTTACACTAT
ATACACAAAATAAAAATAAATAGTGTATGTACAGGTGCTTTACATTCATGAATATGAGTA
TATTTGTGGATTATGACGATGTACAGGTGAGTTATGGACATTAAATTCCTTTAATAACAG
GCACAGTTTCAACCCACTGCTGTTTGCGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1036, 1292..1437, 1513..1649, 1747..1897, 2017..2118, 2401..2494, 2596..2727, 3040..3177, 3287..3529
1001..1036, 1292..1437, 1513..1649, 1747..1897, 2017..2118, 2401..2494, 2596..2727, 3040..3177, 3287..3427
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved