Tetraodon_nigroviridis Locus nifk
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis nifk
Tetraodon_nigroviridis
nifk
2
ACA64, ACA64
1833..1932, 3278..3408
4717
GGGCTCCAGACCCGGGGAGATGTTGATGATGCTGCCTTTGGGGTTGTAGAGCTTCAGGA
TGTCATTAGGTCCTGCCTCGGCTGCAGAGCGGAACAGATCTGGAATGGGCGGCAAGCAGC
CAGACAACTCTGTGTTATAAACAAGCCTCTAAAAATTCCAAGTTTGAAAAAGCTAAAAGA
GGAGGCTGCAGGTGAGCACAATTTTTATATATTCCACCAGGCTGAATCTTATTCTGAAGA
ATAATTGATTTTTTTCGGTCTATGAAATATTATAAAATGATTGTAGAGTATGGCTAGTCT
TCTTCGAGCATGGTCTGGGACCATGGTGTGCACTGACAGGCTGTCAGCAGCAGCTGCATC
ACTGCCTTCAGCTCACACGACCGCCGTCACACTTTCTCTGGGCTTCTTTCTGACCAGCAA
AAATAACCTTGATTATTTTTTTCTTCTGTGAGAACGGCTCACACCTCGGTTATCTTCTGT
CAACAATTATCTAATCTGGGTTTATGCTTGAAATCGGAACACAGTTGTGAACCAGCCATC
AGTCCTTACCTTTGATGTCCAGGGGAGGACAGTCCACTGGGAATTCAGCCTGCTCTGGTC
TCCCATTCACAGTGAAGTAGATGGTTTTTGTTGCCATGTCATGAACTCTGCTCATGTTGC
TGTGTGCACTCCTGCCGGTCTCAGCTCATTATTTCTTTGATACACACTCCGCCCTCTTTC
CACTCTCCCTACCTACTTCTCTGCTCCTCCTTGTTTTTCCTCATTATTGTCCACTAATTA
CAGAATATTCTAAACATTTTCTACAATTATACGTTCTCACACACCTATGACGCGATTTTC
ATCTGCTTAGCCCTTTTGTTTATTTATTTCCAACAGTATTATTATTTTTTTAAAACATAA
AGGTTATTTTTTTGATAAAAGCCAGTGTCGTGGGTCCTCTTGGCCTGCAGGCGGCGCTGT
GGCGCTGTGGCTTTTCCTCGTTTCTTCTTTGGTTGATACCACATGTGCAACAGGAAGAAG
AATCCAACGTGGTTTGGAGAGTTGAGGCGCTGCTCGCTAATGTTTCTTTTCTGAGCTTTA
TGTCTCGTAAAATTTTGTAATAGAAATGACGGAGAGTAAAGTAGGAAAGGTACCAGAAAC
AGCTAAAGAGCTGCTGGCCCTAAACACCAAACAAGAGTCAGAGTTCAAGAAGAAGGTGCA
GGAAGCGAAGAAGAACAAATCCCCAAAGGTGCGTAAAAATGAATCCTTTAAACTCGATAT
TTTCCTTTAAAAGACGTTACACACTATCATATTCTCCGATTGTAACGCTTTAGCTAACAC
AGTCAATCAGCGTTTGTTTTCAATATTTATAGTCTTGCGGTCAAATAATTAGCTCTCTTA
GATGCATTCTAAGCCAAACAGATGTGATTATAAAAAATAAACCCTTCGACTGGATGGATT
TAATCGATTAAACTCTGTAGGTATAATTCGTATGAACAAGCACAAAAACAGAAAGGGTTT
TTTGTATTCAAATTTTAGGTAAGAGAATAAGCATGTTTCATGGCAGAGAGGAAAACAGCC
AGCCTCCACAATAAGAACCATTTTAGACGGACCATTTTAAATGGACACAGCTTGTCATCT
GTTGATTTATTTAGCATTTTATTCTCTTTTCCGTGTATAGGGAGTCCGTTTATCCCCTGG
AGTGATATATGTGGGTCACCTGCCTCAAGGTCTGTTTGAACCTCAGCTCAAAACCTATTT
TGAACAGTTTGGCAAAGTCCTGAGACTGCGGCTGTCCCGGAGTAAAAAGGTAAAAACCAG
TACTGTACCTGAGCGTTCCTTCGTTGTCTCGGCTCAGACTGAAAATGAGCTCAGATGTCG
CGCTGGTCTGAGGTCAGATACCTGAGCCTAAAGTATATTGGTGCATTTAGCTTATCAGCT
GCTCACCTGTTGGCAGCGTGATAAAACCCATGTTCCTACAAAAGATTGAAAAAAGCTAAG
AAAAATAGTTGTTAGAGGATGCCTCATGGCCATTGGTCTCCAAAACTATTCCCTGAAAGA
AGAAAAAGTTATATCATCAATAAATGTGTGATGAATATTAACATTAAAGCGTGAAATTGA
TCAATTCGAGTTGCAACTTTCTGTCTGCAGACAGGAAATAGCAAAGGCTACGCCTTCATT
GAGTTTGATTGTGACGATGTTGCCAAAATTGTTGCGGAGACCATGAACAACTACCTGATG
GGAGAGAGACTCATCAAATGTAAGTATACATTTATATCAGTATGACTCAATTTGATTTAA
AAAAAAAAATGCAATCAGGTTTGTTGTAATAATGCGCACACAGACACACACACACACACA
CAAGATTTCCTATTTTGGATGTGTTTTTATCCATAATTGAATTTTTACTGTAAATAAAAT
ACAAGTCTTGTTGTCCTACAATTATTACATGTAATAACACCAGATAGACAGCGGGGGGCA
GTAGAGATCTCTGGCCATGACGCGTTCAAGGTCGGTCTGTAAATCAGAAGCAAGAACAGT
CGTCAAAATGGCACATGTACAGATATATTGTCTTGTTGCATTTTTCATTGGCAACATCTA
CATATTATATCAATCTGTATTTTGTAATAGTTGCTAAAAATGTTTGTCCTACTATGTTTG
TGTTATTTTAGCAACATTATTATTTGTAATTGTTATTTTAGCAGCTTTATAGTTGCTGTA
AAATTCAAGTGAAACATTAGTAATGCAAATTTTCAAGAATATTTTTGAAACACAATTTAG
CATTGTTGTCGTAGTTGGATGATTAAACTGATTAGAGCCTTAAGAGTATTATTAATATGG
ACTTTTACTGCAAACCTCAATAGAATGATAGTTGCAAAGATGGTGGACTGAAGATGAGGG
GTACTGTTTTCTTCAGGTCATGTGATGCCACCAGAGAAGGTGCACGAAAGATTGTTTGTT
GGCTGCGAGAAGAAATTCACCAAACCCAGGCATCCAGCCGTGGCGCGCTACAACCAGAAG
CGTACAGCAGAGCAGGTAGACAAGATGACGGAAAGGCTCGTGAGAAAGGAGCAGAAGCTC
CGCAAAAGGCTGGCGGCTCACGGCATCGACTACGACTTCCCAGGATTTGTAAGTCTATTT
GACCTTGTCAAAGATTCATCCTGTCCTGCACGTGCTTGCGGTAACTATCTGTGCCCTTTG
TGTTCCTCCAGGCTGCACAGGTGCCTCAGAGGAAAAAGGCCTCCGGAGCCGTAGATGCGT
CCACGTGTAGTGAAGTAAGTGTTGAGTTTTGTTCAGGCACAGACTGAAAATGGTCCCTGC
TTTCTCAGTGAGTTGGGATCAGACAACTGTGCCCACAGCAATCGGGTACATTTAGCTTAT
TGCAAGTACCTTTGAGTGTCTGCGCAATAAAACCCATGTACCAACAACGGGGCCACTCAC
AAACGTGTCAGGCCTGGAGGCTAGCTTGAGGATGAGATGGATTAACCACATCTTCCTCTT
CAGGATGCCACACCCGTCTGCACCCCATCAGTCCTGGAGAGGAGAAAGTCCATGGTTTGT
TGACGATGATGACGCAGATGATGAGATCGTCATCAAGATGCCAACAGTAGAGAAAGAGGA
AGAGGAACAGGAGGAAGATAGTGAAGAGGACGAGGAGGAAGAAGAAGATAGTGAGGAGGA
GGAGGAAGAGGATTCAGAAGAGCCCTCAGAGGAAGAGGAGGAGAATAAAAAGGTTTAGTG
AGAGTGAGGTTCTTCACTGGCTCTTTGTGGACTAATATCAGAGGAAAGACTGAACCATTG
GGATCGCCTGATGTTTGGGAGTAGTTTGGAACTACTCATTAAATGAGGCACATTGGTGGC
GTTAATTAAATATAACAAAGATAAAGTGCCCTATGATGAGGGCATCTGCCAGCTGTTCAC
AGTTAGTGGAGTGTGAAGACTCACATTGGCCCAAAACATCATGTTTTATTTTATATTAAC
GTTTGGATTTTAATTGTGTAAAATGTGATCTAAAGAAATGAAATGTTAAATGTTCTGTTT
TGCACATGTTGACACTATGGGCAAAATAAAAATGTGCAGAAGACAGTAAGGATGCAATAC
TAAGTTGTAGGTTGGACAACAATTTAATGTAATTGTGACAAACTAACAGTTTTTTAACAC
TAGTAGATTCAGCACCTCAAGATGAGCAAGTGGATTTGGAATGGAAACTTTTTTTCCTTA
TTCTAAATCAAATATTTTCTTGTTTCCAGATTTTTTCAGACTGTAACTTCATTTATACTT
TGGAAATAACCATTTTATACCAAATAGACTAATCCCGAAGCCGCCGTTTGGGCCTGCAGG
TGGCAGGCGCGGCCAGTAGGTGTCGCCAAACACACCTTTGTTTACCTGCTTCTCCCATTG
CCATGCGACAGTGCCATCATCCCCGGACCGACTGCGCATGCGCGCGACGATCCCATTCTC
GTCCTGCGGTTCGAATTCCGGGTGGAGAGAGTGAGAGAAAGAAAAAGAAGTGATTTCCCA
ACCCGACATTGGATATTTCCAGCCAGCATCTACGCGCTGTTCGTCCAGGGCCGGCGCCAA
TCGTCTTCGGGATATGGTGAGTGTGAAGGCGGGGGAGGAAGGTCCGGCTCGCCGCCTCCC
GGTGCCAGTTTGCGGTCTTTCTGCTGTTGATAAGTCAGGTTTCATTGAAAGCGCTAGGAG
CTAGCTTAGCTTCCATTCTCTACACCCCTGCTCTGTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1227, 1660..1788, 2130..2238, 2896..3107, 3191..3253, 3483..3533, 3673..3717
1105..1227, 1660..1788, 2130..2238, 2896..3107, 3191..3253, 3483..3533, 3673..3717
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved