Tetraodon_nigroviridis Locus fam122b
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis fam122b
Tetraodon_nigroviridis
fam122b
1
snoU109
2103..2250
7246
CAGATGATGCTTGACACGCCGGCAAACGAAGCCTTCTCATTGGACAGCTGTGGCTACGT
AAAGGGGCGTGTTCTGTGCTAGTGATGTAGCCTGCTGTATGAACGTTGAGGGTCTGGATT
TCTTTCTGCTCGCGGTCTGTAGAAAAAAAAGAAGCGAATTTAAAAGGCATTCATTTTGAA
GCAGATAGGGTGCAGTTCTTTCGAGTTTACTGTAGTATTTAATTGTTTTCTTGTACAAAC
ATTAGGCAAAATGGTGGCCCGGCCTTTTGTTGGGCATAGTATTGTGGCCACTGGCGTCAA
TGCTAACCTAGCTAGGGAGTTAGCATATAAGGCTAAGTACCAGTGCTAAGGCGACTAGTT
AGCAATAAGTGTTACATCTGTGGTGTACATTAGCAAGCTTTGTGGCCTTGATTTGAGTAC
ACCCTCACTCGGTGAGGTAATACGCAAACACTTAACCTGCAGATGAGAAACTGCTGGCTT
TGGTTGCGGTAGTTAATTTACCGCGCCGACGTGAAACTAGTCTTGTAAGTTGCTGTTTCA
GACGTCACCACGGCGGCCGTATACCAGCAAAGTAACGGGTCGGTAGCTAACAGTTACTGG
ACATTGTGCGGTATGTAGCCATAACATGCTAACCATCCACCATCCGTGTTGGTTCCTCGT
CATAACGTTGTTTGCAGCGTTAGCACAAGCCAGTTCTCTCTCTGTAGGTAGAAATCGTTT
ATTTTAACGCCAAGTTTATATAGACTCGTTAAAAAGTAGTTTTTGGAAAGCTAGTGTTAA
CTGTATAGACCACAAGGCCTCGCTGATTGCACAGGGTTGACTACATTGCGTTAGCTAACG
TCGGTCTCGTTAGCTCCATTGCGGCTATGGCGTTTTTTTTTCAGAGCCCAAATTATTAGC
AAAGCGCTCAAAGAAACTATGTAGCATCTCTCTGAATTTTTGTCAAGTTTCATCCTCATT
AATTAGTAACGCTAGGTAATATAATGAACAATCCTGGGGTCTTGCAACAAGAAAAAATGG
ACCTGGATCTGGAAATCCCATCTTCATTAGTTCAGACTGATGGACACTTGAGAAGATCCA
ACAGTGCACCTATGATAAATGGCCTAAGGTTTAACAATGCTGTGCAATTTCCTCAATCTT
TTAGCCAATCTCATTTACATGTAACAACAGTACCACTATAGGCATGAAGCTTATGACATG
ACATCTGAATTTGTTATTCCAGTGACAACTCCCAGGTCTTCCAAAGAGAAGTACTGCGCA
GTCGGAGAAACAGCACGACAGTTGTGAACAGACCCAATATGGTACAATTGTTACACTTGT
AATGTGGAATTGAATGTTCGATTCACGCAAATTGTTCTTCACAGGTCACGTCATCACCGG
TTCGTGTTCCCAGCACAAGACTCCATCAGATTAAACAAGTAAGCAATGGAAAATAAGTTC
ACACTGTAGTTCTTTGACGTCCTTGGCACTCATCATGTCTACTCAGAGCTGCAAGCACAC
AAGTTCACTGTCTGCTAGAAAATTATTCGCATCTGTTTTGTGCAACAGTTATGCATTATA
TAATCTCTGCAGTGATTTTAATATTTTGAGAGAAAGAAGGTAGATGCAATGTTAATTCTC
AAAGTTGGAATTATGGTACATGTTTGAAAATAATTTGAGGCACTATCAGAGGATGCATCT
ATTAAGAGTTGAGAGGGTGACTGTAATAAAATAATTAAATTTGTAGCATGCGATTTGATA
ATGTCACAGAAAGTTTGATTTTGCCTATGATCTGCCTAAGTCTGAAGTCAGTGTGATTCA
GGCATTCATAGATAACATTGTAAAATATGAAACTGTGCTCATGCAGGAAGAGGGGGTCGA
CGTGATGAACAGAGAAACCGCTCATGAGCGGTAAGTTTTGTGTTTGTGAATGAAGATGTT
GTTTAGGATTTATGTCCCCCCACGCACCTTTTTTAGTAGACGTTACTAAACATACTGAAT
AAGGTTTGTTTTGTCCATACAGAGAAGTCCAAGCTGCCATGCAGATGAGCCATTCCTGGG
AGGAAAGTCTCAGTCTGGTAAACATCACTCTTTATTGTTTTTGCCCCTTTTTCACACCTT
TAAGAGCATGTTTGGACCGATGGTCATCACTGTCCTCTCAGGTTTTGTGGAGAGGATGAA
TGCAAACATGCTACATTAATACTTGAGGAGTTAACAGGGCCACCAGTCTTTCAAGGACAG
GCTGGGTCGGTAGTATAATACTCCAACACTGAGAATAGCTCTCCTGTTTTCCTGATTTGT
TCTGTGTAGAGTCCAGTTTGTGCCTATAAACAAACCAGTGGGACCTCACTATCATTCCCC
ACTTTATTCTAATTTGACCGTTCTGCTCTCCAGTGTTCCCAGGGCTCGTAAACTCCGTAT
GTAGGCTAATATTATGTTTCTTGATTGGAGATTCTGACTGTTATGTTTCTGCAGAGTTTG
CTTGTCATGTTTGAAGCTTATTTCTAAATCTAGTGTAATGATTAAGCTATTTGATATGCT
GCTGTAGATGCGTACAAAGACAAAATGGTCACAGGTGTGGAACTTTTGTGTCCCCAGAGC
GACAACGATTTGGAAAAGTCGGCATCTTCATCCCCGAAGCGCATTGACTTTGTACCCGTG
TCTCCTGCCCCATCACCGACCAGAGGGATTGGAAAAAAGGTACTCGCATGGTGTTTTTTT
TTTTTGTTTGTTTGTTTTTTGGCTGAATCTAAATCAGTGCTATAAACTGATAACTAATGA
GGCACTGTTGTTGTTATTGTCATTCCTGAACCGTTGCATGCAAATATCTACAATAAAACA
TCCAAAGATGTGCTTTATGCGTTTTAAGGTCCTGGTAAGCACGACGCAATGTACAATTAC
TGTATTTTCACGACCATAGGGCGCACCGGGTTATAAGGCGCAGTCTCAGTTACGGGTGTA
TTTCTGTACTTAAGCCATACATAAGGCGCACCGCATTATTAGGCGCATGCTAAAACATAC
GGTATAAAACGACAACGGAAGTAAAACAGTGAGTTTCGACACATTTATTCAACAAAATAT
TCATTCTGCCGCCACAAAACCATCAAAGTTTTCATCTTCTGTATCTGAATTAAACAGCGG
CGCTATTTCAGTGTCCAACATCCCGAGTTCCTCATCTTCATCGTCTTCATCAGAACTCGC
CGACCGGTTCCGCTTCAACGTTAATACCGGCTTTTGCAAAAGATCTCACAATACATGAAG
ACGGTATCGTAGCCCAGGCGTATACGATCCACCCGCACATGGTGGCATAAAGTGAGCCTC
ATACGCGTGTCGCTTGACCGGTGCCATTTTAGGGGGTCCTTACGCAAGTACCGGTAAATA
GTGCTCAGCGGCACACCTCTGCTGGATATTCAGCAGAGGTGTGCCGCTGATCGATGGGCA
GAGCCTTTACCGTAGTGCACCTACCAAAGGCACACAGCAGATTTTGGAACTCAGTCCACA
CACAAGGCGCACCTTATTATAAGGCGCACTGTCGATTTTGGAGAAAATCTCAGTGTTTTA
GGTGCGCCTTATGGTCGTGAAAATACGGTAAATATGAAATTGTTCTGTTTCATTTCACTC
CCAGAAATGACAAAGCCCAATCTCACACAAGAAAGTTAAGGATTAACTGAAGTCACATTA
CTGCGCATTAACCTGAATAGTTGTGTTTTTAGGTGTCACTGCCATATTCTGATGAATAAA
TGCTCTGATCTGGTTTTATTTGAATGTTAATCTGTTATGATCTTGACCCCTACCCGACCT
CTTGTGTGGTGCGAGCAGCAGTGCTTCTCCCCGTCACTTCAGATCCTCGTCAGCAGCAAC
GGCCTCACTCCCAGCCCGATACCTAGCCCAACGCGACGCTTTAGGTGAGGATTGGGGCTT
GTTATTTTTGTGTGTGTCCGTCCGTCCGTCCAAACATGTTGCCACGTCCAGTAATCTGGG
TTTAGTTAAAATTTTAGTCCAGATTTAGCACCAACTCGCTTCAGTTTGCATAACTTGTTC
ACAATGTAACAATGTTTTCGAAATTTTCTGTCATAGATCCCATTAGGTTTTTTTGTGCTG
TTTTGGTTGGCTTGCTAGTTTGCCACAGTGTTTTCTTCTTTTTTTTCTTAGCCGGCGGAG
TCAGAGCCCCATCAACTGCATCAGAGCCAGCATCCTCGGGCCAATAAAACGTAAAGGTAA
GCGTGCCTTTTTTTTTTTTTAAAACAATAACACGAACAGAAGAATCAATGGAAGCTGAGG
TTAAAGGTTGTTAGAGTAACCATTTAAATAGATTCTTATTGTTTAAAAATAGGAGCTTGT
CTTCAGTACACATGTAATTAAGGGGTTTAATTATGTTTTTTATCATGTGTATCACATGCC
ACTTATCGTAGCTGGGGGTGATTGGCGCTCTTGCGGCAGCAGGCTAAAAAGGTGGACGCT
TTTTAAATAATTTTAGCAATTGTCTGTCCTGTGTTTCAGCGGCTCTAGACCTCAGATTTC
TAAACCACAGTCCCTGCAGGAATCAGAACAATGCCCTCTGCTGCCAAATATACCTACAGT
GAGCATGTCTGTGGTCATCATGACATATTAATCTGGACATGATGGCTCTGCTTGTTTTTA
CAATATTCCAGACGGCTCTCGGTAATTATCTAATTTTAGGAATCCTATCTGCAAAATCAT
GCATATGTTCTCTAAAGACTATCTGTCCAACATGTTAAAGTAGTCTTTGACCATTGTAGA
AAACAGGATTGATGATAGGAGAAATGTTTAGAAATTAATCTGTCTTTGTGACATCCAGGA
AAAATTGTAAAAACAGGCTGAATCGCAAAACGACGCCTTTATCTAATAATGAGAAGGACC
AATAATAAGATGGCTGCTTCAATTTGTGATTTGATTTTAAAAACATTCTAACCCAAAAGG
GAGATTTGCTTCGTTTGACTGACATTTACGAGCTGTAAAGAGTCTGCTGGTTGACTGTTT
CCCTTTATGCATTTCACTTAAATTTCCTGTTACCTGGGAGACAAGACAGTCACATGACCT
CACCCCAGAGGTTACATTAGCCTTAAAACAGTGCCTAAGAGTGCTACATGTCACTTGTTT
TTGTAGGTGAAATGGAGACAGAGAGCCAGCCCAAAAGACTCTTCCAGGGTACTACCAGTA
TGCTGTCCTCAGACGTCTCTAACCTATCAGATATCAGTTCCTGGTAAGATGCTCACTGTG
TGAATGAAGTTGCACATGATTACACAAATCATGTGCAACTTCATTAGCGGCGTCCTCGTA
GCGTCGCATGGAACAACGGAACATGACATGCGTCAAGTGAGACGGATGTAATGGAGAGAA
TCCGGCCGCTTTTCAAAACAAAGCATTAAGACTCCGAAAAAAAAATAGTGGAAATTATTT
TTTCTTTCTTGTGCGGCCCGGTACCACATGACCCACGGCCTGGTTGGGGACCAATGGTAT
AGTACACTTGTCAGGCCAGTAGGCGGCGGTAATAAACCAAACACGTGTGTGTTTCGTTCA
TAACTATGAATATTTTTTAATTAACAGTTATTAGAATGGCGAGTGCCAAAGTTTTCCAGT
TGACTGATGACAAGGTCACTGCTTCTACAAGCAACCCTGAACTGTAAAACTAAAACACTT
AGCGGTTTGGGGTTGATGCTAGTCTTCTTCATTCTTAGAGTTCATTTTTTTGTTTTGCTC
TTAAACAGCAGATGTGGTGGCATTCACGAAACCCTCCAATCTGAAGCCCTTTTTCGTATT
GCTCAGGTTTCACATTTTTTAGTGTTAACAGTCAGCTCAAATCAAACTAAAGCTTTGCAT
TTTCATCATGCAATGCTGTGTAAACGGGGGCTAATTTAAGATCTAGATGAGGGTAAATAT
TCAACATTCTCCCTCTGAAAAGGGTCCCGTTTGACCTGAATAAAATTAATTTATGGAAAG
TTCATCATTGTTGGTATTTGCCTAAAGTAGCCAGGCACATTTTCTGGTATTTCTCTGAAA
CATCTTATTGCAAGTTGCTGTATTATTCATGGTATTTACTGCTTTTGATGCCCAGCATCT
AAGAGTGCTAACACAGCTTCTGTTTTAAATTACATGTGACCCTTATAGTCATTCTCCTGA
TCTGCTGGATGGAAGCCTCAGCAGTGTCAGCTCCTCCACAGACTCTCCAGGAAAAATGGA
AGGAGTGTCACCCTCATCTTCTAGCAACTCCCCATTTGCTTGTCTACAAGATTTATTGCC
AAAGTGAACAGAAAGAGAGTGAGAGAATCTGAATGGGTGGGAGCCCGACCCTTCTCTCTC
CAGGAAAGATTTTTATCTCAGAGTGTTACCCTCCATCATACACTGAAGAATCCAGATGTT
TAAATTGAAGAGGTGGATCCTAGTAGAACTAGGATTGGCTGAGGACACTGAACACAGCTG
CTATTAGAGGATTTAAGATGTGATCTTGGCCTTATTGACATGTTCTTTGATGGCTGCATA
TCATTCCATCATTCCATCGGAGGAGAGTGATGCTCGGCAGCAGCCTGATAGGAAAGCCAT
TGCATGTATACATTTCCTTGTCTCTTTCCTGCAAAGCATCTGTCCACAGGCCTTTGTGTA
TACAGACTTCATTTTTTTCCCTAAAGATTTAACTTATTGTTCTCCTCTTTTGTAAGTATG
TACATATGAACAGATGTTGTATATAGATATAATCTTGTGATGGAGCAGGTCTTAAAGGCT
TCTTTTTTGACAAAAGGAAGCTCAGCTCCTAGTGTATATTGCCAGATATTTGCCCATTGT
TGAGCTCCTAAGTTTCAGATGTTTTTATTTTGAGGATTGCGTTCGTAAATTTACATCAGG
GCCTATATAATATATCATTAAAGAGGCCATTAAGAATCTTTGGAACCAGTGTACATCTAA
ATACCCATATTTGTGGATCTACTTTCCTGGGGTAGTCTTCAAAAACGGCATGTTACTGAA
AGGGGATGCGTGGCCTGATCGATTTTTGTAGGGATTCTTCTCCCTTTGAACACTAAATGT
TCCTGTTTATCCTTTGTTCTTGTCAGGACATCTTTGTAAATGTGCAAAGTGTATAAGTAA
TGGGCAGTTTTGTTAAACAAAATGTTATTTATGACGTATGAAAAGTTTATATAAAATTAA
GGTTTCCACCCAAGTAGAGGGCAGAGGCTGGATTGTATCCAACCACACTGCTGTGTTGAA
GCGAGCGCATGGCTCCTCGCGGTTACACCCGTCAGTTCATTTGCACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1107, 1222..1300, 1364..1417, 1846..1889, 2002..2056, 2577..2678, 3798..3883, 4128..4195, 5106..5202, 6108..6246
1001..1107, 1222..1300, 1364..1417, 1846..1889, 2002..2056, 2577..2678, 3798..3883, 4128..4195, 5106..5202, 6108..6246
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved