Tetraodon_nigroviridis Locus Mono:SNORA74
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Mono:SNORA74
Tetraodon_nigroviridis
Mono:SNORA74
1
SNORA74
1001..1199
2199
TGGTGGAAACCATATTCTTCTGCAAAATGCCACCATTCATTGCAGTTATAACATGGACC
GTTGTCACTAACCAGTCTCTGGAATTCCTAAAAAGGTCTGTTTCGACTTTCTTCCAGTGT
TCAATAGGAAGATCAGGAATCATCATGAGTTCTCTACCTGCTTGCTCTGGAGTTTTTTGA
ATATTTCACACTTTCCTATGATGTCAATGATGAATGACAATCTGATTGTCCCTCAGTAAC
AGCCTGTCTGCCACCCTTAACTTTAGACCGAGCACACTCCAGGACAGTAGGTGGCGGTAA
TGCACCTTTTTCAAATAGCCATCCGCCAATAAAGAAAACGAAGAACATTTTTTCCCACAA
TTCAGTGCGACACTACTTAAGCGTTCACGTATATTCCGTTCCCTCTCTCGTACTACGGCA
ACCATGTGGCGCGTATTCAACAGGGGCCTTTTCAAGGCATATCGTAGGTTTCTCTTTTTC
ATTCATCAATTTATAAATCTAGTCAAGCTGTATGACGTGACCTGAGCAGTAGAAGTTAAA
TGTTCACGTTAAATATTAAAGGCTGCCTATAACAATTGAGAAAATGCATTTAGAACGAAT
CCGTTTTGGCGTTTATGTTCTCTGTCACGTTGAGTTGATTTAAATTCTGTATTATTAAGA
TGTGCGGCCTTCAATTCTGTACCGGTAAAATAAATGAAAAGTCTAGCTAGCTAGGTGTTT
GGTTTGCTGGAGTTGTGCAGTAGCCCACGTGGACGACCGCGCGTGCTCGTTTGCCGTCCT
GTTAAAGATGAGACCTGATTGGCTGCCATATACGTCAATCAAGTGCCAAACGCTATAGTA
AGGATTTTTTTTTTTACCCCCCCTTTCACAGAATGCCGTGTGACCGACACCCCGAACGTA
CTGGTCCCCCCCTGAGAGAGTGATGGCGCTGTCACCATCCTGGGCACCGCTAAAGAGTAG
AGGTAAAGTATTTATCTGTCATCCCCCGCTTCCCTGCCAAACCCAGCTCTAAGTCAGCTG
GCCAGACGGCGTGTTTGGTGCAGTGTTACAGGGCTGGTAGAGGAAGACTCTGCTTCCGAG
TGCAGCTGTGCAGACTCTGTGTTAGAGTGTGCTGCTGCTGCGCTGCTGCAGGGTCGAGCC
CGCTGAGAGTGGCCTGCCCTGACCCACCAGCAAGGCAGGCCTAGTACAGGGCTGCACATG
TGCTCTCAGGCGACCACGACGGGCGTCTGACATTCAGTATTACCATTCCTTTTATCATTA
CAGTGCAGTGATTTGTTTTGAAAACGTTCCTGTCAGTGTTTCTCTGTTGAAGGTGTCTGT
GCACGTCAATTTCCTGATCTGATTTTTTTCCTTCTCTCTTTTTTTTTTTAATGAAGACGT
GGTTTCCCTGCCCTTCCTGGTCATTTTACAATGATGGTGAGTTTACGAGACTAATTGTAT
CTTTTCACGCGAATGCTAATGCTGTGATGACTAAAAATACAACACATCATGCAGACAAAA
AACTATGGTGACATTAAAACCCTGAGCATATCGACTGGAATGCAGCAGGAAGTGCTGGCT
GTTGAGGTTTACTGACCTAAGTTCTCCGTCTGTAGGGGGCTAGCAGCCGTTTGAAGGGGC
AGCGCCCTGCGTCCATCCATGGAAAGGACTGTGAAGTTCAGGTACGTCCGTCCACAAGAG
TAAAAAGGTTACGGCCATGTTTTAAACCAATCGTGTACTACCATGGCAGATCCCTCGTTT
CTGCTGTGGAATCTGGTATTGGAAGATGAAACTCTGGTCTTTGGCACAGGTTTTGGTGAA
AACGGCTCACCAGATCCTGACTGAAGACCTGAAACACCGTTTAATGTCTTATACAAGACA
TGAGCTCGCTCTGCCTCGTCTAATTCTAACGTTTTCTCTGTGTGCCTGCAGATACTGTGT
TCAGCGGGGTTTGTTCCGGCTCGCAGGGTGTTACTGGGACTCTGGGGAAGCAGCGCTAAC
GCCAGCGGAACACAAGTCGACAAAAGTCCAGCCCCACCTGGAGTGTGTTAACACATTTGG
TTCTTAAGATGATTCCTCCAGCACGAGTGGAATGGGCATTTGATCGTGCTTTCTGGTGAA
GTCTGATCTGTGAGAAAATGAGAAATGAATAAACTCTTTAGGATTAATGTTTTAATAATG
CTCAAATGAGAATTCACTTGTAATCCAGGAGGGGTTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved