Tetraodon_nigroviridis Locus rpl39
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis rpl39
Tetraodon_nigroviridis
rpl39
SNORA69
1660..1754
3153
cttagcccacgccattgttctagctctctgaaactctttgtcctctccactccaggacc
gacctgccatccagttgtaccaaccaggggccaggagccgcaatcggaccacgggaccgg
gacccgagttggccggcaggaagtcagacgcagagatggagaaagcgtccgacaaagcag
acgagtgagcagacgttcggaggacaccgccgtcacggcagtgacgctgtggtcggtgcc
gcggggccacggcccccagctctcccagtctcagagggcctatttatagagcctcttgtg
cctgaacgccaccctttttatttacatttgtcaggaaagttggcagaaagccgcagatct
gaagctgtaagtcacgtcaggtggagactttgaccttttttgttcacaagttggataacc
taatacatatcacactggaatattcagtcgattattgcagagttctcggttttactttgt
acttaatttggtctttcttttctaagtccaacagttaaactaattattagagtttttatt
taagtctgttaaagtctgtaatgacaaaacacgtcccctacatgtaattgaaacatgatg
gatcacaatttgtttttgtaacttttctttctatattaggaagaagtagccatttcagac
actgctgttgtgtgacattatgcagccttaagacgatgaccctgtggccttcaccatttt
ccaatctggaaccccctttttttctacatggtggttaagctattggcatgactccacatt
tctgcaaatgacagtttctacctttgaccaaaaataaaaggtgccatttccatgttgaaa
atgtgcgttatttgctcactcatcagcattggtaattgttttttgcgtcttctgttgaat
attgttctctttaattaaacagcgaggtggtgcagttacaggagtcaccacaaggtgtcg
ccacccaaaatgtttatcagataacagtgagacgtcacgtcCTTCTTTCTCTTCTTCCGC
TGTCATAGTCGGGAAGACACTGTGGACAAAATGgtaactacaaaatctttaaacatccgt
atctgcacgttgcgtactcgactgttgtgctttagttcatcacttaatgtttcagcaaag
atttttagatatatatgttgcttatagtcgtggaaatgagctaataaaacactgatgcta
gccggttccattccgtgccgctatgcacgttagcttttagcttgtttcgcagagtttact
tggcccattgaatttagtttccattagctcccaaatttgttcatttacaactgttcgttc
gtcgtttccagTCGTCCCACAAGACTTTCAGGATTAAGCGCTTTCTCGCTAAGAAGCAGA
AACAAAACAGGCCCATTCCTCAGTGGATCCGAATGAAGACCGGCAACAAGATCAGgtgag
ctctaatgaagatattacacttcataccagtactattaataccaagctttagagtataca
tcttatttttccagcgattgtaatttagactatagcgaactgcactgcagcgctagttgt
tcatagaaaggttagtgttgcattcatcactaggtcaactttaatgcgcacttgctccag
ttccagtgtgtttaggtgcttgtttggtccagatgtgtgtaaagcaggtctgcaattgca
gcagttcttgtggtggagtgctgtcattaaccctgctgagagcatcttcatcctcctgcc
ggagagctcacactcctcttcactgtcactgggctgaggaagctccaaagctgaacattg
ttgttggtccaggcttaggtgtttagtcagaaaaagactggtctggaaccattctgggtc
aaccatgggatcggcttcacgtttctttaggtttcgactgagtctgtgaatgacatttta
agtcctgttgtctcttttcctgctccagGTACAACTCCAAGAGGAGACACTGGAGGAGGA
CCAAGCTTGGCCTGTAAGCACACAGGCGCGTGGCCCCCCACGTCCCCCCACGTCAGCATC
TGTCGGGACCTTCAGCTGCTGGGACTGAGCGTGTGTGATCTGAAGCAGCAGTTTTGTACA
GACGTTGGTTATGCTCATGTTTGACATTAAAAGATCCGTGATCAAACTTGAAaacgaagc
tgtggctttattccccgtttctgtctccgagcaggtcgtgtgtgtctctaaagcaaaacc
aaatgtttaactgggttagaaatgttgctacagaagggaaaaacctttgaatctgaccac
aagagtcaaagaaaacatcatctttaggacacacaacacaagaaatggagtaaaagttgt
ccggtcgggaaaggaaaacgcgttaaatgtgcaccgaatgctaacaaatgtggactagtt
gttttaggacagtgataattcttgctgataaacagtataaacatgagtttaaatcccctt
ggatttgaggagggaagtaaatcttgtttagaaatacagtaaacagttcaagtaacccag
aaaggagagagagggcagcattcactttattcaccccaacacccaggcccccgcacagac
cgccccgtcatcgggggacaccccgtaggttctccgctagcaccggttcgtcctgaacgg
tggaaccagaaccagataccagtaccagaaccagaaccatcgttgctgctgctgtcgttg
ttcgctattcagcgtgcacgtccagcggttgctcgtcgtcccacatgcccagcagctcct
gcatggccggcggggcgtctgccggcaggtactgcaggctctcctgccgctgtggtccat
ggcgtccacgctggcgccgaacgctcccaccaggactttgaccacgccgtagtgccgctg
catgctggcgacgtgcagcggggtcacccgccgctgccgcgcacgtccacgtccaccggg
atgcccacgcgctgcgcgtaatgcaccagctggagcagagtctcgtcctggccccgcttg
gcgagccagtgcagcaccgcgaacccgctgatggagtccctccggttcagcaggagcggc
tcgctggagatgaactccagcaggctttcatagctgccgtccacggcggacaacatccag
gcgtgttccgtgggaagcagaccccagtccgtgt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1052, 1331..1434, 1948..2151
1050..1052, 1331..1434, 1948..1996
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved