Tetraodon_nigroviridis Locus nucleolin
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis nucleolin
Tetraodon_nigroviridis
nucleolin
1
SNORA57, SNORD20, SNORA75
4096..4232, 5198..5267, 5506..5632
7122
AGAGCCAGTCAGAAGTCACGGGTGCGAAAAGCAATGCTGCCTCTGTGTGGTGCAGAAAG
GATATTACTCCGACGTGCTGGTTCATAAAATACAGAGACGTCAAGTAAAACGTCTGCCCT
GCCGTGAAAAACACCCTTTGTATTTTCTCTCTTGTGGGTTCAGCATCAAATGCTTTTCTC
CTTATTCAGATGGGACTAGTGTGTGTTACCGCAGTAAGATTGATGCGCATGGCACTTTCC
TAAAAGCTGGAACTGGGGTGCCCCGTATTAAAGAATTACACACCAGTCATTTTGATTACA
AGCTGTTTGATTCCGAGGTATCACGAATAAACTGTAAAGAGCATTCAGAAGAAGGGAAGC
TCAGTTGCAGATTGTGGTACGTCCACATTTACGTTCACCTTTGAACCGCTTGATCAAGAA
AACAGAAGGCTCAACTATGGCTTCACCACATGAGCTGAAGCGCCCTGGCCGACATGTGGC
ACCGCAAAAGAATGATGGACGTGTTGCTTCCTTTGGACCCGTCAGGTTCTGCACGGTGGG
TCGCACATGTGCGCCAACCACGTGGTTGGCGCACAGCTGCTGGGGGTGTAGAAAAGGGGG
CATTGTGCAGAGTGAACATTTAGGCCTTTAAAAAAACAAAATAATATGTATATCTAGAAA
TATGACGGATAAATGACAACAAGCGGGAATGAAAAGACTGTAAATTAATTTCATTAATGT
ATTTTTTTTTTCATTCCGTCTGTTCACTGATCTTCGGCGTATGGAGGCAAAGCGCGGGCA
CGGTAAAAACTACCAACACGTGATTGGTGGAAAGAGCCGTGTGGGCGGGTCGACGCGAAC
GCGCAGGGGCAGGAGAGTTACGAGCGCGTCTCGGGCTAGTCTGTCTTTCCTGTCCAATGT
CCCGTCGACTAGGTTGAGCCACGTGTGTGTGTATTAGAAATTTAGTCAGTCGTTTCCAAA
CGTCCAGTTTCTTGTGTTTCATTGAAACACGGTCCAGCACAATGGTGAAGCTAGCAAAGG
TAAGAGCATAGTTCGTGATTTCGGGAGTTTTACTGTTTTATGGTACATTCGTTAATGCTG
CGTTTATGCACGAGGCCTTTGCGCAAAGTTCCTGCGTATCGGCCGAGTAAAATAAATCGA
TGTTTGGCGAAATATGGAGTATTTTACAGCGGGTAACACGTAATCGATACCGTCGATTGG
TAGTGTGCTTGCATGGTGGACTTGTAGTCTTAGAGTTCCATTTCGTCTTCGTTACGGTCC
TCCATGTTTGCTTTCAGGGTTTCCGGCCTGCTAATGAAAACCGGACTATTCAAGATGGCA
TTCCTAGTGCGCGTCCTCGGCATTAACACAGGGTTAGAACTACGCACTACAAAATAAAAA
CCTTCTCACGCTAACTTGCGAGCAGCAAAGAGACACATGGGTTGTGAATATTGAACAAGA
TAGCGTAAGCTGTTAGAACTAACGCCGTTACTTCGACGCTCGTTAGCATTAGCACTGGCG
TTTATGATACACACGCGAGGCAGACGCCTGTTTTGGGCCTTATTATTTTTACAATCATTC
GCAACTCGCAGATCTCCCTATTGAAAACGCAAAATGGCCTGCTACTAAATTTATATAAAC
CTTGTTAGTTTAGCACGTGGTAAATTTGCTCATGGTCTAATTAGCCGACAGGTAACTCTT
CGGCCTCTGTCGCTCCACGTGGGTTGTGCGTCTGCTTTGAGTGACACACGAGGTGGACCC
CAAATCTAGGAAATCAGGTCCGCCCCTGGGTTTTTAATGTGCGCCTGTTTAAAGGTATAT
TTAATTATTCTTTTGCGCTGTAATTAATGTGCAAGTTTGCAGGTATTTAGGTTTTTTACG
CTTTCACGTATCAGTGTGAGGTTGCTGAACACGCTGAAGCAGCTTGTGAAACCATCACAC
CTCCCCCCACTTCTAAAAAAGTACCTACATGGTTCATTTTGACCAATGTGAACATGGTTA
TTAATTTTTTGTCCTGTGTCATGTAGGCAGCAAATAAGCAAGCAGCTCAGAAGAAAAAAG
CGCCTCCTCCTCCAAAAGAAGTGGAGGAAGAATCCAGTGAAGAAGAAAGCAGTGAAGATG
AAGAAGAGGTAAGCTTAAATTGCAGTCTTCTTTTGGCCATTGACATCTGTGGGCATTGAA
AGAGAATAAAACACGGTTTGGGGATTTTCGTTGCAGGCACCCCCACCTAAGGCTGCGAAA
AAAGCCACCCCAGCCAAAAAAACTCCAGTTGTGAAAAACGGAGTGGGTGCCAAGAAAGCA
GAGAGTGAAGATGATGATGACGACGACGAAGAGGACGAAGACTCCGGTAAATGGCTTTTA
CACTTTGTACAGCCTGAACTGCAGCAATGCGTTCAGCCATGTTGTAATGTGTAATTTGAT
CACTAGGGGGAGTATTTCTTAGTTAGCATACAGTCTGTTAGCACACTGGTGAGGGGTAGA
TATGAGCTGTTGGAATAAAAAAAGATTTCTGTTTTGGAGTGGGCTAAACATGTCAATCAA
TGGCGAAACACGATTGGCGTACTGAGCCAGTCCTTTTGTCTAAATTCCACAGAGGAGTCT
GAAGAGGAGGCCCCCCCACCAAAAAAGACCCCGGCAAAAGCAACACCTGCTAAATCCAAG
AAAGCCCCCGCGAAAGCCCCCGCAAAACCCCCCCCAAAGGCCGAGGAGTCTGAGGACGAG
GAGGAGGATGATGATGAAGAAGGTAAGGCTGCTTTTGGGGGGCCGGCGAGTTGGTGGTGT
TGTGGCTGCCGGTTTGTGTTCACTGAAAATTGTTGCGTCTCGTGTCCAGAAGAGTCAGAA
GAAGAGGCTCCACCACCCAAGAAAGCAGCCAAACCCGCAGCTAAGCCTGCTGCAAAGCCA
GCCAAAAAACAAGCCGCAAAGGCAAAGCCTGCAAAAGAGGAGTCCGAGGAGGATGACGAG
GAGGAGGAGGACGACGAGGAGGACGAAGACGATGGTGAGGCTAACTGGTTGCAGGTGACC
ACTAGCAAACAGCAGGTCAGCTGTGAGTTGCTGTTGCAGGAAGCAATTTCCAGGGAGTTG
CCGTGTAAATGATGATCTCTAAGGGACTTAATGCTGATTGGGTGTGATGTCACGTGCAGA
TCTGATGCTGGTGCAGAGCTGCTGGCCCAAAGGTTGGCTGGTGGGAGCTTGACATTAACG
TTGGGCTTTTTCTCTTCAGAGGAAGAGATGGACACCACCCCCGCTCCAGCTGCAAAGGCC
AAGAAGGCAGGCATGGTGAAGGCCAAGGAGGAGTCGGAAGAGGAGGAGGATGAAGAAGAC
GACGACGAAGAAGAAGACGACGATGAGGAAGATGATGACGACGAGGAGGAAGAGGGTGGG
TTTTAGTGATTGAAATGTTAGTTTTAAGTTTATTGTGTAGAATGAAACATCTCTGCTTTC
CTAGCACAATAAAAACAGATATTCTGGTTTCTTCTGGTGATTTTTAAATTCAGCTTTGTT
TTTCTCTCCAGAAGCTCCCAAAACTGCAGCGAAAAGAAAAGCAGAGGCCAAGAAAGAAAC
GCCGCCTGCAAAGAAGGCCAAAGCCGAGGGTGAAGGTGGGAGCTGCCCTGAGCCGTCAGA
CGTGCGATTCGGGACCTTTCATTTAAAATGCACCAAAGAGCAACAAGTCGGTTCTCTCTT
CTCAGGATTTTCGCTGTTTGTCGGAAACTTGAACTCCAACAAGGACTTTGTCGAAATCAA
AACGGCTTTGAGAAAGTTCTTCTCCAAGAATGATCTCGAAATTGCAGATATCCGGTTGGG
CAATTCCAGGTAAATAAGATTTTTTTTAGATCTCTAAGAAGAAAAGTGCTGATTTTGTCT
TTTTTGTTTTTTTGCTCTTGGACACTGGTCAGCTGCTGCAATGACTCTTACGTCGCCTGT
CTTTTGCTCTCTCTCCCGCAGGAAGTTTGGCTACGTTGACTTTGCATCCGAGGAGGACAT
GCACAAGGCCATGGAGCTGAACGGCAAGAAGGTGATGGGTCAGGAGCTGAAGCTGGACAT
GCCCCGAAGCAAAGAGACCGCACAGGAGGACAAGAAAGGTAAAGATGTCTGCCTGGTGGG
GAAAAATGACCCAGGCCCTCCATTTCTTGGCATGCGTGAGTTGTTCAGTACTCAGGCGTG
TAATGTACGGAGGAAAATAAACTGCAGTGCTATGTCTTCGGTGCCGGTGCGTTTAAATGT
CTGCCGGTTCTATCCTCAATCACTGTAACATTATTGACAGACGGGACTCGGAGACCTTTG
CCTCCACGTGTTTTCCGACTAATTCACCGAAACTAATTAGCTGTGCTTCTATTTGTCCAC
CAGAGAGGGATACAAGGACTCTGTTTGTCAAAAACCTTCCCTACTCCGCCACGGCTGATG
AGCTTAAGGAAGTCTTTGAAGATGCGGTTGATATCAGAGTACCTCAAGGCCAGAACGGCA
ACAACAGGGGGTAAGACCACGCCCCACGGTCGGGGGTCCAAACGGTTCCACTTGACCGGA
GTGTTGAAGGATGGAGACGCAGTTGGAACGTTGGTATTTATCCAGATTTCTTTTGTCCTG
TCAGCATTGCTTACATCGAGTTCAAAACTGAGGCTGAGGCAGAGAAGATGCTGGAGGAGG
CCCAGGGAGCCGATGTCCAGGGGCGCTCCATCATGGTGGACTTTGTTGGAGAAAAGAGCC
AGAAAGGGGCCAAGGTGCCAGGTAATGGAGCGGTCCGAATATCGCCCTGCAGAGGGGGGC
CTGTAGGGTTTCTCATCTAATCCGTCACCTGATCCTTCCAGCAGCGTCAGGGGCAGCGAG
TAAAACGCTGGTCGTGAACAACCTGGCGTTCAGCGCCACAGAGGAGGTCCTACAGTCCAC
GTTTGAGAAGGCCACTTCCATAAGGATTCCACAGAGAGATGGCAGACCTAAGGGGTAAGT
CCTGCCCGCACGGGTTTGTGAGAGGAAAGCAAAAGCACGTGGCTTTCCCCCAGTTCTAAA
TCGGCGCCCGTCTCCTCTAGATTTGCTTTTGTGGAGTTTGAGACGGTGAAGGATGCCACA
GACGCCCTAGAAAGCCTCAACAACACAGATATCGAAGGCCGCTCCATCCGGCTGGAGTTC
AGCCAAAACAGCGGCAGGGGAGAGGGCGGCAGAGGAAACTCAGGTAGGCGCCGATGGCCG
AGTCAGAGCCAGAATGAGAGCTTGAGCTTGAGTGGGACCAGACATGATGAAACTTCGTCA
TCCAGAAACCCCGTGAGGACTCAGAGAGATAGTCAAGTCCTGATCTGTCCTGCGCGTGGA
TCGCAGCACCTCGCTAGTCTGTGATCCCGCCGGTGCTGAAAGGGTCCTTTTCTGCCACCA
GGTCCAACAAAAACACTGTTCGTCAAAGGTCTGTCCGAGGACACGACCGACCAGAGCTTA
AAGGAGGCGTTTGAGGCGGCCGTAGCAGCCAGAATAGTCACCGACAAAGAGACCGGCTCC
TCCAAAGGGTGAGTGTCCCGCGTCTGTCCGCTCCCAAAGCTGTTGGCTCTTCTCATGAGC
ACCACTCTGTCTAACGGTGACAGTGAATGGATTCGCAAGAGAAGTAGAGCAAAGTGACAT
TTACACAAGGCATTTACCTAGTGGTAGGTGCCCATGTCCAATGTGAGACATTTCAGAGAA
ATGTGAGTGGGCGGGGTCTAAGCTGGGGTTCCCCTTCTGACTTGCTGGTTTTTGTTTTTG
TCTTTTTTAATTTGTGTAGGTTTGGCTTTGTTGATTTTGACAACGAAGCAGACTGCAAGG
CCGCCAAGGAGGCCATGGATGACGGCGAGATCGACGGCAGCAAGGTGACCTTGGACTATG
CCAAGCCCAAGGGTGACGGCGGCTTCCGCGGCGGGCGCGGCGGCGGCTTCGGAGGGCGCG
GCGGTGGCTTCGGAGGGCGCGGCGGCGGCTTCGGCGGGCGCGGAGGCGGCTTCGGAGGAC
GCGGCGGCGGCGGCTTTGGCGGACGCGGAGGCGGCAGGGGGCGCGGAGGTGGACGTGGAC
GCGGCGGGTTTGGAGGTAATGTTTTTAATCTTGACAAACTCACAAGATGATAAATATCTA
TTCCTTTTTGCATCCAAATCTTTTATTTTCATCGTAGGTGGCAGAGGTGGCGGCGGATTC
GGCGTCAAACCCCAGGGGAAGAAGATCAAGTTTGATGACTAGACCTTTAGTCTGTTTTAC
TTTTTGAATGGACTCTGGTTTCATCGATTTTCAGAGCTTTTGGACATTCCAGAAAGCATC
GTGGATTATATATTTAACTGTCAACGGGCATTTTGGCCCTTTATTTAGCCTCCATAATAC
CTCCCTTCCCCGTGTGTGCCAGGCAGGTACTTTTGACCCACAAAGTGCTATTTATTAGTA
CTGAATGTCCCTCATGCGAATCTGCATCTGTTGCCCACAGTATCTTAAAAATCTTTTGTT
TTTCTTCTGTTTTTTTTTTTTTTTTCTTTTCAGAAAGTGAAATGATATGGGTCTGACAAA
CATGTTTGCTGTGACGAATCTGCTTGCCTTTGTCAGAATCCTTGTGTAAATGTACACAGT
TTATATGATTTACTTTTACCTTTTGTAAAAAAAAACAAAACAAAACTCAAATCCACCTGT
ATGTTCGTTTTTATTTTGTTTAGTTCCCGTTAGGTGCCATGTTTTACTGTGACGTGTTCA
AAGCATATTTTGATAGATTTAAGTCCGTGTTCTGCAGTTGGGTAATAAATGTGGCAAAGA
AGTTTCTGTGGCATTGGAGGAGGGCGGGAGGGGGGGGCACAATTAAGGGTCGGGGTCACA
GTGGATGATCCTGTTATGTATGTAACAAATGTTTGTAGTGCGCTGACTAATTTTTTTCCC
ATCTGGAAACCTTGGATTTTCACAGGATTCAATAAAATCTTGTAGGTAGTGATTTTTAAA
TGTCTGTCTTTGTGCACTTTGAAGCAACGCGGTGTCCATGTTGCGCTATTCCTCGTTGGA
CCACTAGGGGACACTCGCCGCTCGGTATTAATTGGGGTCATACGCGTGGCTGAATATTTA
TACACAGTTAAAATTAGATATAGAATCATATGTACAACTATTTTGAAATAAAGTCCAACA
CTGGCTGCCAGTGCCAACATAATTTAGATGTTAAAAGTTAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 2006..2107, 2196..2295, 2572..2721, 2809..2925, 3193..3262, 3400..3455, 3473..3574, 3665..3788, 3921..4057, 4323..4449, 4564..4700, 4781..4913, 5000..5142, 5341..5467, 5719..5827, 5975..6014, 6097..6122
1001..1018, 2006..2107, 2196..2295, 2572..2721, 2809..2925, 3193..3262, 3400..3455, 3473..3574, 3665..3788, 3921..4057, 4323..4449, 4564..4700, 4781..4913, 5000..5142, 5341..5467, 5719..5827, 5975..6014, 6097..6122
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved