Tetraodon_nigroviridis Locus Poly:SNORD74
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis Poly:SNORD74
Tetraodon_nigroviridis
Poly:SNORD74
1
SNORD74, SNORD75, SNORD79, SNORD77, snosnR60_Z15, SNORD47
1001..1082, 1476..1543, 2089..2170, 2302..2378, 2514..2588, 3268..3338
4338
TTGGTTCAGCGACTTTGATGATAATCTGTTTGGGTGTTTCACAACACACACAAGGGAAG
GTAAAATGATCTTTTAAATCTTACACAATGTCTTAAAAGAATTGAAATTTAGATGCTAAG
GTTGGCATTACTTTGGTCTGTTCTTCCATATATCCTTGTACAATATGTTAAGTTGTGGCC
TTTGCATACATTTCGTTACCATAGAAGCTGATTTGTGTTTTTAATTTTGATCATAATGAT
TGTATCAGATTCTCCTGTTCCTATTGATGCATAATATTAAATTGCCATGAATTTCCTCCT
GTGCGGTTTGGTAATCATTAAAAGAGGAGACAGGTAGGCTGATAAACTGATACTTGTATT
GATTCCTCAAGGTCTCAGCAAACTGTGTCCTTTTAAATCTTGAATGAATAAGGTGACATT
TGGATACGTTTTATTACGTTATCTAACTTTTTCATTCGTGTGTTAAATGGAATTCAACCG
ATGTGCAAGAGCATCTTTTACAGATACAATGATGAAAAATATCCTTTTAAAAAGACTGAG
CACAAGATTTGACAGATAATTGTCTGTTACTATGTGCGCTGGGTCTTGAATTGTAGTTTT
TTTTTTTTTAAACCCGGAAGTGCGGCCAGCTCGCGAGGGCGGTCGTCCGCCGCTGCTTTC
CCATCATGCTTTGCGGGTCCGGGTATAAAAGCGAACGGCTGCCGGCGCCTGTCCTCACTC
TCTGGTTCTTCAGCTGGTATGTATTTGCCTTTTGCCTGATTAAAAGGCCTTCTGTTGTTT
TATTTATTTATTTCTTTATTTTGCTGCAGAGTCGTCCAGTAATTTGTCGTTTTAGCAGTA
ATTTGACCCATTTAATTTAAATTTGCTTTTTTTTTTGACGTAAAAGGGCTGTTTGAGCAA
AGGCCGCGACCACGTGTTAATGTGGATTTGCCACTTAGCACTACAGCTATACGTTAACTT
TTTTTTGCATTGGATAAATTTATTTACGAAGAAGGCGCTCTCCCATGAATACATGATGAA
AAAAGTGTTGGTAGGGACATCTGAGATAAGGTGAAGAAATGCCAACTCTTCTGATTTCAT
GGGACGACCACTACTTTAACTTGTGTTAGCTCTAAGCTAGCTGCAGTAGTGGTCGAAATG
GTGGATAAGCTGGTCGGTCGTTGTGCGTGTCTTTTAGTTAAAAATACAAGTTAAGATTTT
ATTTTAACACAAAAAAAAAACAATTTACCCATTTTTGTTGACAGGCCCGATCTCTACAAA
ATGGAGTTTGACGTGAAGTAAGTAATCAGATTTTGCACACCATTTATGATGGTAAATAAG
AGGCTTTTTTTTTATTGTTACAACTTAAACTAATAAACCTCGTGGTCTTGGGAAATTTTA
TAATTTTTCTTTCTAATTTTAGGTTCACTGCTGTTGGACTGTTTGGCCTGACATTTAACG
TAAGTTACATGTAGGTAAGAGTTCCCACTAGTGTAAAGTCTGTGATGATCCACATGTGAG
AGTAGTGGACAGAAGACATTTCTGAGCAATCTAATGCTGAGACTTGGGTAGAAACATGAT
TAAAGTATGTGAATGTGCAAGTATGAAGTTAAAGTGTGTAAATGTTCACAGGGGTTGGCC
ACAGTGGAGATTCCTCATGAGGGCTGAGCGGCAGACCAACAAGGTGAAGTAAAATGTTTT
TTCAGTTTTTGGGCTTGATGATGCTTCTGTGGTTGTGACATGTTGAATTTACATTCCAAA
CACTTGGATTGCACCAGTTTTGTTCCTAATTGCATAAATATAAAAAATGTTGGCATCAGT
TGCGACCGGAGAAGCATCGTTCTGTCCGGATCACGCTCGTGTCCTTGTGTCGCTGTGATG
ACGTCATATTTGCTACTCTTGACGAAATGAATGACGAGATATATCCCACCTACTCTAAAC
TGAGCCTCACAAGTACCTGCCTCGCCCTCAGAGATGGCATTTACGGCTGCTTACGTCTTG
CTCTTCTTGCAGATGCTCCAGTGACTCTTTGAAAGCTGCTTCATTTGAACACTTAAGTTC
AGGTATTCAACCTTTTTTATATATACAAAAATTATTTTTTTCCAAACCTAACTGTTAATG
ATGATCTTGTTTTAAAAACAATGGGAATCTCTCTGAATTAGAGTGAAAGATGACTTTTAA
CTGACACAGTACAGGTAGAAATGCTGATGTAGCTGGCTGGAGGGGCCTGTATTCATGCTG
AATATATTTCCTTGCAGGTGTCCAGACTCGCTCTGCTCACAGGTGAGTGAAGCCTTTGAT
TAAGTGACGTTTATGACGCTGGATGCAGTGATGATTGCATAGTTCAGCAGACTAAACTGT
GAAGAACATTCATGTCTTTCGCTCCTAGCTGATGTGTCCAGCCTCCACAGGTGACACTGC
AGCAAAACCCAGAGTGGTTTTTAATAGTTTCACACTTTTTTTCCAGAATCTGGAAGCACC
AATCGGACAACTGGAGGTGAGTCGGACAGATGATCATTTTGTATTTTAAATGGGTTGATA
CAATGATGAGCCCATAGTTCAGCAGAAAAATCGTGAAGAACAATCTTTCGCTCCTATCTG
ACGTGTCAAAGGTCACCTTCCTGTGGCCGCTGCGTGCGTTAAACCTTGCGGTAACCGGTG
TCTTTTCTTACAGGCGGATGACGTTGCCCACTCACCGTTGGTCTTCACGCCCGTGACGGT
GAGTAACCATGCAGACAGGGCTGCTGTGCACGTGTTCAGATGGGATGAGTTTGAATCAGG
TCTCTGATCCAGTTGAGGACATGTTAATAATTCTGATCTGGTTTCAGAATTTAACTTAAG
TGAGGATGCATGACAACAGGGCTTTGACCTAAACTCTGTTACAGGACTCCGGTGTGTCTG
GGACTCCTCAAGTCTGCGCTCGTAAAGGTGAGTGTTGATGCGTGTTGGCGAGAGGAGAGC
CAGGTGAGCAGAGTTGACCTGTGCTGTCCTGAGCTGAACTCTGTGCCATCCTGGTCCGAG
TGGCTGTTGCACTGACCAGTGTGATGACAAATGTAAAGGCTGACACCTAAACGTGGAGTC
GTTATTAGCTCTAACTGACTTGGTCCGTTCAGGTGTTGGCCAGAGTGGCTTTGTTGGGTT
TATGTATAACACCATCTCCTCTCCAGGGTTCAGTGTGGACTGGAACTGGTGACGTGTGAG
GCCCATCAGGATTACCATGGTGAATACTTGACTGATTTACCCTGGTCAACATTAAATAGT
GGAGTCATGGTTGGGTTGGAGCCCACTCTTCCTGTGATGATCAGATTCTGCCAGATGATT
TCTGATTATAATAAATACCGTTCCATTATTTCTGAGGTTGAGTGGTCAGAAAACAAACAG
ATAATGGTTCAAGACTTGATAAAGCTTAGTTTCTAATGCCTAAACTTTGTTTCTAATGTT
TCTTTTGACAGATGCGTCCACACAGCTGCAGATGTGTACTGATGACCTTTGTAATTTGTC
AATAAAACTTTGGACAGTGTATTTTGGTTTTTTTTCTTAACTGGGAGTGAATTGATTGGC
TTAAGCATGGATGCTCAAAAGTTAAATCCAGGTGCTCGCAGCCACTTGAGCGGTTTTTGG
GTAGTCGGGCTTGCATTATTTTTGTAGTCCAACATAATCTACAGTAGTTAATGACAGTCC
AGAAGATTTGAAGTTAGTTTGGGAACGTGTAATTTCTAAGAGCTACTGACCAAGCCGCCT
TCTAGGATGAATCCTATTGCAAATTGTCGCTGAGTCTTCCGTCTTAACCTCATTAAACGT
AAACCTGACGTCAAAAGGAAGCGCCACAGACGACTGGCTTCTGCTTACGTCACAGCTCTG
CGACAATCCGCATCCGGAAGTGACGCATAAGTCACTGCACTTGGGTAAAAATTACCCTTT
TTTGTTTATGTGCTTTTAGCTTTGTGTTATCTTGTTTAAACCAGGACTCGTATTTTTCTT
TATTTTTTAATATTTTTAATGTGGTCTTTGTGCGCACGTTCATGTTAGGCGGAGTTTATC
GGTGGCGAAGCGCGAACATGACCGAAGAGCAAACGGAGCGCCCCTCCCCGGTTGTCGTGG
GAGTGGCGCTCACTTCCCTCAGCGATCGGGCCTCCTCCTGCATCCTGCCGGCGTGAAATA
AAGTGGGGGCCGATCATCCGGACGTCGTTCGGGGCCGACCCGTTGGCTGACGGTCATGCG
GTGGCTGCTGCTCGTTCTCTGGGCTCTGTCCGCGGAGGCTGACTTCTTCCAGCTGGACAG
CCTTTCTAACGTCTCCACCTACTATTTCAATTACTTTTATTGCAGCATATGGGAGGGAGA
CTGCCAGCCTCACCAGGAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved