Tetraodon_nigroviridis Locus eef2a.2
snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis eef2a.2
Tetraodon_nigroviridis
eef2a.2
1
SNORD37
2298..2364
6045
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCCACTGTTTATTTTTTTGAGAGTCTTGAGTTTTGCT
ATAGCTGTTTGCTCTTGTTTACTTCTGATGTTTTTGCTCGTAGCGCCATCTCCATGTTCT
ATGAGCTTGATGACAACGATCTGGCCTTCATTAAGCAAGCTAAGGATGGCAATGGCTTCT
TGATCAACCTGATTGACTCACCAGGACACGTTGACTTCTCCTCTGAAGTGACTGCTGCTC
TCCGTGTTACTGATGGTGCTCTGGTTGTAGTGGACTGCGTCTCTGGTAAGAGATTTTTTC
CATTTTAACACATGCTAATTTCTGAAACCACTTCAAACTGTTTTTCTGAAGACTAAAATT
TTAACACGACCACAGGCGTGTGCGTACAAACGGAGACAGTGCTCCGTCAGGCAATCGGTG
AGCGTATCAAGCCAGTTCTGATGATGAACAAGATGGACCGTGCCTTGTTGGAGCTGCAGC
TTGAACCCGAAGACCTCTACCAAACCTTCCAGCGTATTGTTGAGAATGTCAATGTCATTA
TCTCAACCTATGGAGATGAAAACGGACCTATGGGCAATGTCATGGTAAGCAGCATCAGTG
TTTGGGTGTAGACGCGCATCATTAGTCCAAATAGAAATCTATGCACCTAATGCAATTACT
TTCCAAATCTAGCTTTTTTTGTGAATGCAATAAACATTAAAAATAAATGAGGACTGTTCC
TTGACTCTTTTGCCCCAAGTAAAATTTCTGATTATTTGTCAAGCTACAATAACATAATGG
TACACAATGTTTCAATGCTTCTAGGTTGAACCTGTTTCTGGTACGGTTGGCTTTGGATCT
GGACTCCATGGCTGGGCTTTCACTCTGAAGCAGTTTGCTGAGATGTATACATCAAAGATG
CTTGCCAAGGGTGGTGACAAGATGACACCAGCTGAGCGTTGCCAGAAGGTGGAAGATATG
ATGAGAAAGCTCTGGGGTGATAAGTAAGTTTTATCAAATAGATGTAGCTAAAACATTGTT
TGGCTGCGTTTCTAAAATATTACACTGCCTTTTCCCAGGTACTATGATGTAAAGCAAGGA
AAATTTGTCAAGGCCAGTACCGGGCCAGATGGCACCAAGTACCCTCGCACATTTGTGGCA
CTTGTCCTGGATCCAATCTTCAAGGTAACACATTTAACAAAACTATGGCAGCCTAGCATT
ATGAGTCGGTGAGGTCTGCAGTGACGTTTATTTACTACAGAAATGTCTTGAAATATACAT
TACCTAAGAAGATGGTCATCAGCTGGTTGAAGGGTTATGTAGAACTAGGGTGATGACCTC
TGGCAGGGTATTGGAACCTTAAAAACTATTAATTTGTTAAATAGTTTTGAAATCCAATAA
TTCTGTAATATTGTGCCTGCAAATGATGAGTTAAAACATTCTTCACTTTGACCTGATTGA
CAGGTGATGATAAATTTGACTGAACCAGGCACGGTTGGGTTATGGGAGCTTTTTAAATCT
ACGTTTGACTTCTCGGTCATTGAACATTTACTGCCTTTTAGGTGTTTGATGCAATCATGA
AGTTCAAGAAAGACGAAACTGCAAAGATGATCCAGAAACTAGACATCAAGTTGGACTCTG
AGGATAAGGACAAAGAGGGTAAGCCCCTCTTGAAGGCGGTGATGCGTCGCTGGCTGCCTG
CTGGAGAAGCTCTGTTGCAGATGATCGCCATCCACCTGCCTTCCCCTGTCACTGCTCAGA
AGTATCGCTGTGAACTCCTTTACGAAGGACCATCAGATGATGAGGTTGCCTTAGGTAAAT
ATTGATTGACCAATGCTTAACATCCACTGAATACATTACCCTGCTAAGTGCCTGTGTTGC
GTTTTTAATCAGGTATCAAGAACTGTGACGCCACGGCTCCCTTGATGATCTACATCTCAA
AGATGGTCCCCACCACTGACAAGGGTCGCTTCTATGCTTTTGGCCGTGTGTTTTCTGGGT
GTGTTTCTTGTGGTCAGAAAGTGCGCATCATGGGGCCCAAATATGTTCCTGGGAAGAAGG
ATGACCTCTGCACTAAACCAATCCAGAGGTTGGTTTTTATGACTGATTTCATTTATATTA
CCTGGTGGTTTGTTGTTAATGACAAACTTTCTACAACCACTTTTTGCCAGGACTGTTTTG
ATGATGGGTCGTTACATTCAGCCTATTGAAGAGGTGCCTTGCGGTAACATCGTGGGTCTG
GTTGGAGTTGACCAGTTCCTTGTCAAAACTGGAACCATCACCACTTATGAGCATGCACAC
AACATGAGAGTGATGAAGTTCAGTGTCAGCCCTGTGGTGAGAATTGCTGTGGAAGCCAAA
AACCCTGCAGATCTGCCTAAGCTGGTTGAGGGATTGAAACGGCTGGCCAAGTCCGATCCT
ATGGTGCAGTGTATCATTGAAGAGTCCGGAGAACACATCGTTGCTGGTGCTGGAGAGCTG
CATCTTGAGATCTGTCTGAAGGATTTGGAGGAGGATCATGCTTGCGTTCCACTCAAGGTA
ACTTGACTACTTTAGTAAACTTGTGTCGTGCTTTTGCACTCGTGTGCCTAAAACCTGACA
TTGGTTTGTGTTTTAGAAATCTGATCCCGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAAGGGCAGAAGATATTGAAAAGGGCGACATTACCTCTAATCAGGAGCTTAA
AGCCCGTGCCCGTTTGCTTGCTGAAAGGTATGAGTGGGATGTCACCGAGGCCAGGAAAAT
TTGGTGCTTTGGGCCTGATGGGACCGGACCAAACTTGTTGGTGGATGTAACCAAGGGAGT
CCAGTACCTCAATGAAATCAAGGATAGTGTTGTGGCCGGCTTTCAATGGGCTGCCAAAGA
GGTAAAGAGACAAATTATTTTATGATGTCGAGGTCATTGGCTAAATATTAAGTTGTGTAA
ATGTTATCTCTAGGGTGTCCTCTGTGAAGAGAACATGCGTGCCATCCGCTTTGATATCCA
CGATGTGACCCTTCACACTGATGCAATTCACCGTGGTGGTGGTCAGATTATTCCAACTGC
GCGCAGAGTTCTGTATGCATGCGAGCTCACAGCTGCGCCCAAATTGATGGAGCCTGTTTA
TCTGGTGGAGATCCAGGTGAGTCTATTTTCTAGTTGGTTAAGAAATTCAAGAGTGGTGGT
AAATTGCAAAAATACAATCAACTTTGCTGTCAGTGCTTACATTTGGAGTTGTCACTCATT
AAAAGTCCTTGGCAAACTGGTTTATGCCTTGTTGTCCTGACATACCGTTGTGTCTACTTC
TCAGTGTCCTGAAACTGCACTGGGTGGAATCTATCAGGTGTTGAACAAGAGGCGTGGTCA
ACTGTTTGACGACACCGCTATTGCAGGAACACCTATGCATCTTGTGAAGGCCTACCTGCC
CGTCAATGAGTCATTTGGTAGGTTTTTCTGTGCTGTTGTGATTTGCTACATGAAACTGAC
CAAAACTGCCTCTCTCAACCTCAGTCATCGCATACATTCTAAGAGGTAGTTCTAAAGTCC
GATATGCCCAAATCTTTTCCAGGTTTCACTGCAGACCTCCGTTCCAGCACCGGTGGCCAG
GCCTTCCCCCAGTGTGTGTTTGACCATTGGCAGATCCTTCCAGGAGATCCATTTGCCCTT
GAAACCAAGCCTGGTCAGGTTGTGGCAGAAACGCGCAAACGTAAAGGTCTTAAGGAAGAG
ATCCCAGCTCTGGACAACTACCTGGACAAATTATAAACACACGAGACCCTCACGACTCTT
CTCATTCCTCTCATCAAATTTAAATCTGGGGCTTGGACTGTACAGAACACAATGGGCACT
CTTGGCTAAAAAATATCGGTGATAAAGAACAACGTAAAAAAAGTAAACAATAAATAAAGG
AAAACAAACCTTGTGTGTTCTTTTTGTATAGATGGATTCCAGTTGAAAGTGGGAACTTTT
AAATAATGAATTTAACATGGTAATCCAGGTTATACCATGTTATATCACACTTAGGAGTTG
ATGAAACTAGGGTGACTGTACCCGACATGGTTGAAAAAGGTATGCATTAAATCTTAGCAC
TTGTCCATAGGTATGAATTAAAAACAAAAGTTTCTGGGTGTTATCGTTAGTCCAGGAGGG
CTGGGCTCCATAAATGCCACGTTGGCAGATCATACGATTTTAAGGAAATGAGACGAGACG
AGTCGTCTAAAATGAAATTTAAGCCCTTTTTTTTCTTAAATGTTTTACAATACAGCCGAA
AGGTGGCGATAAATTATATTTAATTTCCGCCATTTTATTTTAGTGACCAAGTTTTCACTA
AAGAAACAAGGCAGACTAGTTTCAATTATTCCTTCTTTTAGGACTTTATTTCAAAATGCC
ATTACTGAAATAAGATCATAAATAACGGCAACAAATAACTTGACAGTGCAAGTTGGGCCA
AAAAAACAAGCGAGAGAGGCTCACTGCGAGGAAACGTGAACGATCTCACTCGTAAACAGG
ACCGAGCGGACGCGCAGGAAGCCAGCCAATCATGTCCCTCCCCTGCTGACCAATCAGAGA
GCAGAAGCTGCTGACTTCCTGCTTAGCCGAAGACGTTATTATATGGGGTGAGTTTAAATT
GTTTATTCAAATAAAGAGGTAATAATGTAATGTTATGGTTACCGAATGTAAAGGAATTGT
GCGTGGTGCAAATGTATACGTTTTCCGGTATTTTCCGCACGTCTTGCGGAAAAAAACAGA
ATTTACGTTTCCCCCATAGCGTGAGAGCTGAATAATACCAGTTAGCCGCACTGAACTGCT
AATAGTTGCAGTAGCTTGTCCATAAGCAACATTGGGAAATCAATTTTAAGTGTACTGCTT
TTCTTCTGTTTATCTTTTCGGCAGGTCCTTATTCCCTTAGGGTGAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1184, 1275..1483, 1704..1882, 1958..2063, 2441..2693, 2772..2965, 3048..3416, 3496..3510, 3790..4020, 4093..4275, 4444..4576, 4702..5045
1001..1184, 1275..1483, 1704..1882, 1958..2063, 2441..2693, 2772..2965, 3048..3416, 3496..3510, 3790..4020, 4093..4275, 4444..4576, 4702..4895
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved