Takifugu_rubripes Locus RPL10L
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes RPL10L
Takifugu_rubripes
RPL10L
scaffold_2483
SNORA70
1882..2014
4825
ACACAACTGTCATCGCCTTATCATTGACGCTACCGAGGGGAGCGCAGACTGGACCAAAT
CGTTGGTAGAGGATTACAGGAAGCAAAAGGGTGGAGGAACAGCTGCATCACTACCTGGCT
CTGCACTTAACAGGAAGTCTCATCAGAGGACGGTAAATGCTGCTTTGAACATCACCAGAG
CAGAGCTGCCCCAGTGAAGGAGCTCAACATCCAGCACTGCAGGAGGACCAGTCAGGCTAT
AAGGACACTCGGCACTCCAGTTGCTACCATCTGGTCCAGGATACTGGAGTGTCACGCTCC
ACCCAGACTCAGAAATAGTTTGATTCCACAGGCTATTTTCTGACTATTGCACATTTTTAT
ATATGGTAGATGTGTTTTTTAATCGTTTATCCCATTCTTTTGTATATAACCGTGTGGTTT
GATCTCTCCCGAAGGAAAGTGGTTTGCACTGCTTCTATTTTGTAATATATTTATTTCCTG
ACTGCTACATCCCAGCTGCCAGCAAAACCCCTAAATGTGTTAGTTGAATCATAGATATAC
TCAGGCCCATGGGTTAGGGTTATCAGCACCTATCCTTTGCTCAGCGGGACCTTGGCAGCC
CCCCTACCATCAGCACGCCTGCAAACTTTTTGTCCACTTTTGTCCAATAGCCCTTTACTT
CTCAGCCCAGTCCCTCAAAAGACTGAGCTATCACCAACCCCATTGTCCACATTTTGAAAT
CATTCATTAAAATTCTTCTCATTTTTTTCCTTTATTTTGCTAACAGAAATGCAAATGAAC
ACTGGCTGTCACACAATCTTCTTGCCAAAGATAATAAACTACTAAGGTGTCGTTTTGCTA
CGTTATCATAAAAATGAACTACATTTCCCGAAATAATGCTGAATGCTTCGTTTGCTATAT
TTTAAGTTTATATATTTCAACGACGTGGCGGGAACTTTTCGTGGCTTTTTACCCAGAGTA
CCCTTCGGCCTTATGACGCGCCGGAAGCGGATGCTTCTTCCTTTCCTCCATTAGGTGAGT
TTGTGGCTGCTGCGTGTTGTTTGCTGCTCCTCTCAAAGTCGGCAAATTCAAAGTTCTTTT
TGGAGTACGACTCTCAGTTTTAATGGACTAACGCGTGTGTGTGTTTTAATTTACAGGTTG
CAACCATGGGCCGTCGACCAGCCCGCTGGTAAGTGGTCCGATTGAGTTAGTTTCAGGACG
GAACGGTGCAGAAAATGGCAGCTCCGCCGGACCATGTGGACGCGGCGGCGCTGCCGCCAG
GGCCGCTCTTAGATCAGCTCTAGTGTTCGACTCTGGAAGCTATTTCGTATCTCGCCCATT
TGTAATACGAGAAGATTTCGTCATTTTATTCGAGAGATATTGGACCCGTTTCTGTTATCC
CCCCCTTAAATAAGGTGCGATTGCTAACATTAGCTAGCTCGGAGCTAACGGTAGCTGCCA
TGTCAGACTTGAGGTTTTACGCAGAATACAAAAACATGAATCTTTAGTCTGAAGAAGTCA
CGTTGGAAGTGTGTTAATGCCACATGTGCACATTTGTGGTTCAGCTGTCAGTAATACAGT
GTCAGGTGTTTAAGTCCGTAAGGTTTGAAAGCTGCTTTGTCGGTAGTTCGGCATTTTTCT
AAACGATGACGTCTTCCCCCGCGATCAGACGCGTTCTAGAGGTGGAGATGATGCTTCAGT
CCTGCACGTTCACCGGACCATTACAATGGGAGCCGTTTTAACTGTAGCAGCAGCTTTTCC
TCACAAGAGCTGCAGATTCTAAAGATGACTCGGATGCTTTTTCCACAGTTACCGTTACTG
CAAGAACAAGCCCTACCCCAAGTCTCGCTTCTGCAGGGGTGTTCCTGGTAAGCACACTCC
ACACCACCATGTCTGTCAAGTTGTGCAGCCTATTAAGCCGACTGGTTCTGCTGTGGTGCG
GTTCTGGTGTGCAAAGGCTGCAGACAGTGACTCTCTGGTTGTGTATGTCCTCAGCTGGGA
GGTGCTGAGATCATTAAGGGACCACTGAGACAAACACAGGTGGAGACTTGCTGGTGAAAC
AGTGACAATTCTGCACAGCTTTTCAATCTCTGCCTCAATTTATTTTAAAGATCCTAAAAT
CAGGATCTTTGACTTGGGAAGGAAGAAGGCCAAGGTGGATGAGTTCCCCCTGTGTGGTCA
CATGGTCTCTGATGAGTATGAGCAGCTGTCTTCAGAAGGTGAGTCGCTGTGACCTTTGTT
CCCTGGGGAGACGCAGGCAAGCGTGTTGGGGTGGCGACAAATCAGAATTAATCTGATGGA
ATCATTTATTCAGAAGTGACTGATCTTCATCCACAGACAGTGTAAATTCATCCATCAAAG
GTTCTGATGTTGCTCCAGCTGCTCTTGTTCCCATGGAGGCCTGGAGCTGTTGGATATTTG
AAGTTTTTTGTTTTATTTTCTGAGAAGCTGATGTTCCACTTAGCAAAAGGGTACATTTCC
TGTCCCGAGGCTCCCGTGTGGGACGGCTGACCTCTTTGGCCCACCTTGGAACTGGTCTGG
TGGAAACGCTGGCGAGTTCAGAGACTTCACGGTTCTCCTACTGGGGCTCCGTAGCAGAGA
TGAATGTTGATGTTCCGCGCTCCATCCACACCGAGACACTCGCTGGAAACCATGTGGTGG
AACAGTTATTGAGCCCTGGACATTGGGTTTAGAGAGGACGGAGCCAAGGCTTTAAAAGGA
TCCCGACCATTAAGACACTTAAGCACAATAATTAACGAGCTACAACAAACCCTGTTGGCG
TCTCAGACCGGCGTTTCTTTTCTCGATGATGATGGCGTTTTGATGGGAAATGACCCCAAA
CGTGTAGTAAATACAGAGCGGTCGGACGCAGAATGCAGTGCTCAAACGAGGTTTCGTAGG
TGGCCTCTGACTTCAGAAAAACTAGAGATTACTTCTAAATTGTTAAACGTTTCCCCGGGG
TCCAGATGTTACGTGTATTTTCTCAGTCACTCTGGTGAAACGTCTCTAAAAAACCAACAG
AAGTCCAGTCGAATTCTCTTAAAACTAGATTAAATTTGAAATGTCACAAAATGAGGTATG
TTGTCCTGCTGCGTCTGCTGTTGCCATAGCGATGGCGTGCCGGGTGAAACGTGTCTCTCT
TGGCAGCTCTGGAGGCCGCTCGTATCTGTGCCAACAAGTATATGGTGAAGACCTGTGGCA
AAGACGGCTTCCACATCCGCATGCGTCTGCACCCCTTCCACGTCATCCGCATCAACAAGA
TGTTGTCCTGCGCTGGAGCCGACAGGTGAGTCACCTGTGGATTCAGCCTCCGGCATCGGC
CGCGTTTGAGCCTCTCCTGTCTGTCACGCTGCTCACCTGAACTTCTGCACCTCAGGCTCC
AGACTGGGATGCGTGGGGCTTTTGGGAAGCCTCAGGGCACCGTGGCACGTGTACACATCG
GTCAGGTGATCATGTCCGTGCGCACCAAGACCCAGAACAAGGAGCATGTGGTGGAGGCTC
TGCGCAGAGCCAAGTTCAAGTTCCCCGGGCGTCAGAAGGTGAGTGAGAGGTCACCTGTAC
AGAGGAAGCTGGTTCTGGTGTGTGAAGGCTGCAGACCGTCACTGGTCCTGTGTCCTGAGC
CCAGAGGCGGCCCCTGAAGTGCCCCTCGGGCTGAAACGTGATGGACTCACGTTGATTCCT
TGTCGTGCAGATTCACATCTCTAAGAAGTACGGCTTCACAAAGTTCAACGCCTGCGACTT
TGATGACATGATGGCCGACAAGCGTCTGATCCCAGATGGCTGTGGGGTCAAGTACATCCC
CAACAAGGGTCCGCTGTCCCGCTGGAGGGCGCTCCACGCCAACTAGGGCCGCCGAAGGCT
GCGAGCAGACTTGAATAAATCTGGATTTCATTATACACTCTTGTCATGGTCATTCATTTT
TGAGTCAATAAAATCTTCTTTTACACTGTAATCACTAATGTGTAACAGATTTATGAAGAT
AGAATTTGGGACATATCAGCACACAAACTATTGACAGTGTTTTTTAGGACAAAGGCAAGA
GATACAAATGTTAAAGTTCAGATGAACTGGCAGAACCTGATCCTTCATGGGGCCGAGGGA
TGAGAAAAGGTTAAAACCTTTGAGTAGTAAAGTGAAGATGTTTGATAATCTGGGTTTGGG
AGAAACGATGGTTTTAGGCCAACAACCTGGACTGAACAGCTGATGGAGAGATGCAATTTC
TGGGAATGGAGCAAAGCTTTTCTGCTCTTCTGCCTGGGTTGGAGCTCATCACGGTGTCAG
ATGAAGAACGCTGAAACATGAAGTCATCGCATATGGAGTAATGTGCCCTGGCGGTTAAGT
GATAAATAGCGCCGAATCCTAAATGAGATTAGGTTTCAAGTAAACCGGAATGTTTGTGGT
GCAGTAAAGCAAATGAAAATACCTTTGCGTGAGGAGCTCGGAGCTCGGATGGGAAGTCGT
TTTATCCAATTATAACAGGAAGTTCCGGACTATTTCCTTCCGGACATTTTATACTGCTGC
ACAACATGGCTGCCTGCCTACGACCCACGGTTCTCCGCAGGATGCTTCTCGGAGCTTGCA
GCCTCCGCAGCTGCACCCTGGGGCGCCCCGCGGGGCTCCGGTTTGTCTGCCACTCCGCCC
CGGAAGAGGTGAGAGAATCCACGGAGGAATACAGATACGTGGAGCGGCTCATCCCACCGT
CGCGGGTCCCCGCGCCCCCTGTGCACCCCGGAGCCGCGCCGTCCGGGTGGAGGCCCCCAG
CGGGCTCGCCCCCGCCTTTGCCGTACATGATTCGCCGCTCTCGCGTGCACAACATCCCCG
TGTACGGCGACCTGACGCACGGAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1013, 1136..1167, 1788..1846, 2090..2197, 3126..3264, 3355..3517, 3670..3825
1145..1167, 1788..1846, 2090..2197, 3126..3264, 3355..3517, 3670..3822
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved