Takifugu_rubripes Locus ENSTRUG00000005806
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes ENSTRUG00000005806
Takifugu_rubripes
ENSTRUG00000005806
scaffold_344
SNORD66
6837..6912
13365
TCTTATCCATGTCAAGAGTCGCGTTATTACAAGTCTGACTTATTCTGGGTTGGAACCTT
GCATGCATTGATATAAAACGGCAAGGACCCGCTGAAAACAACAGGCCGACTAAGGTTAAG
GCAAACGGCTGGCTGTCGGTTTCGGCCACGTAGCGTAACTTGGCAAGATGTCGATAGTGG
TGGGACACGTATCGTTAGCCCCGAGCGGCGGTCCCACCAGCTGACGGGCCACAAACGCCA
ACACTCGTAAGAATCTTGACCGACTGTCGGAGAAAAACGCCCCGACCGACACCTGGTGCG
TAGCGACTGTGAGGGCACCAGCCGAGTCGGAACCATGCGGTAGTTTGGTGGGTTGCGCGG
TGATCTGGGCAGCGTGGCGTTAGCCACAAGCTAACTCCTGGGCTAACTGCTGAGTGTGTC
GGCAGGTGGATGGTGACACGTTAGCTCTGATTTCTGTGTCAAACACGCTTTTTCCGCCCG
TCGCGTTCACGAAAGGGCGGTTTGACACGAGTTACGGCCCCGCTTCGTTTGTTGCACGTG
TAGCTCCAAAGTAGCAGCTTTGACAGAGCAGGTGAACTTTGACCCGGGGTGTCCATTTTA
TTTAATCCACTCGGTGCAAAACAAACCCAACTCTTCCACCAAGAGCTGCAGGTTGGTGGC
GAGGCCAGCTGCATGCGTGCCATGAAGGCAGCTGTTCAGCCTGCCCACTGTCATTTCTGA
GGAGTTTGACATCTGGAGTTATCAAGGAATGTGTCAGGAGTGTTGGTGCTCATTGGCCTG
AACACTGTGGGTGTTGCTGGCGTTATCTCTGGCAGAGCCGCCCGCCGCGCCCTCGCCGCT
AGCGTAGATGTTGCCACTCCAAAACACTCCGTTCACCTCATTTTTGTGGTTCTAGCGAGA
GTATTCAGATGAATGACGGATTGTTCCTAGAAGTGATCAGATTTCATGTTTCTTCCTGAA
GGTTGACAACACCACCCTCATGCAGAACCAGAAACGAAGGTGAAATGAATAAACCACCAC
AGCCTATAACAGGACCTTCCTCTGTCCCTAACCCTGCCCCGTCCCCAGGACTGACGCAGG
TAAGAACAGCTGTGTACGCGCCACGTGCACTTCAGAACGCCGACACATGCGCTTTCTCAG
AAAATGAGCCCTTAAGACGCGGCTCAGATCTCATTGTGATAGGTTTCAGAACGTGCTGTT
GTGTTGAATGTGACCCAATGAAGGCGTCAGCTGTGCTAATATCTGCTCCCCAGACAGCCT
ACGGTCCTGGCCAACCCACTTCTCTAGTTTTTGCCACCCCACCACCTCCACAGATGAGCT
CGGCACCACAGCCACGACAGGTACTGCTCCCAGCACGTGCGCCTCCACCCGTCAGTGTCA
GTTTTGCCTCTCGGGCGTCCGTCTCCCGCCTTATTGCTGATGTCTGCTTCTGCTCTAAAG
TCTGTGAGTTAAGTCAGCTCTGCCACCTTTTCTCCCTCTCTTTTCTGCTGTGCTCCCAGT
TTGCTGCAGGGCCTCGTACGTTACACCAACAGGTACTAACTGCCCTCTTCTCATGTCTCG
TTTAAGATGTTGCATGCTAGCGGTTCCACCTGCGGGGCAATTAGCAGCAGGGTTTCCTCG
TGTGGTTCTGGTCCCCGTCAGTCACAACGGGACTCGTTCCCGGCCCAGTTCAGACCAGCC
ACCTTTATCCATTCGGCCCTTAAACTGCTCGTTTTCTGTTCATGTGACATCCCAGCTGCC
GTAGTTACCAGCTTAACGTTCGCCGCCGAGACTCTGGCGCCATCGTTCCCGCTAACGTCC
TGTCAGTCTCCGCCTCGTGCTCATTTCCTCCTAAACTCACTGCCTCTCTTGCTTTCTGCT
CATGTGTTGTGCGGCTGCAGGGTGGATACAGAGCATTACAGGTAACGTCTGTCCCTCCTC
ACCCCCCCTCACCTGGTGCTCGCAGTGCTTTAGCATTAGGTGTCAGTCAGGAGCTGAAGC
TGCAGTAAACATGAGTGTGTGTGTGTGTGTGTGTGTGTGTGTAATAAATCCCCAAACTCA
TGCCTCAGACGTTCCACATTTGAGACGCGAGCTGCTCCACGAGCAGTATTTGGGCTCAGA
TTTCCTAATTTTCCATCCACCCGTTCAGAATTACTACCAGAACCGACCAGCGATGCCCAG
CGCTGCTCCGAGGGTCCAAACCAGTAATGGCCCGCGGCCTGTTGGTCCCGCCCACGTCTA
CCCCTCCAGCTCCCAGATGATGATGATCTCCCAGCAGCAGCTGTCTTTTGCTGGATCTCC
TCAGGGCTACTTCCTCCCTGGGCAGGTTGGTTCTGAGGGCGGCCCGTCATTCTCGTACCA
ACCTCATATTCTTGCCCATTTTTCAGCTGGGCCACTATAACGAGCTGATGTTGTTTCTGG
CTCCTTTGTGTCTGCAGTACCGGGCCCCCTTTATGCCCCCGACTCAGCAGTATCCTGTGA
CCAGCGGCACCGCCAGCTTCTATCCAGGAACCAGCCCTGCGGAATACCCTCCCTATGGTG
AGTGGGCCCCACACCGAACACACCCACCCAAGCCAAGCCGCAGTAATGGAGCCGTATTTG
CTTAAGTTTGAGGTGCCCTCACACACACACACACACACACACACACTGTGTTGCCGTGGT
TACCTGATGGTCGGCGTGTTTGTTTTAACGTGCGGTGCATGTGACCCGGATTAATTCTGC
TGCGATTTGCTTTGGCTTGTTTTCTTTCTCTCTTACCTGATGCTGCCTCACAGGTTCCCT
GAAATGAACGTGCAGTTTTGGGGGGCGGGGGGGGGGGGTAAAAATGTCAGGGGCATTTAG
CCTCTCAAACACCTCAAACCCACGTTTGCTGGGCAGTAACTGTTCAGAACCTGCATCATC
AGCAGAGCGGACGATGCACTCTTCATTTCATGGGACCCGTTTTAACTCCCAGCTTCTTCT
GGAACCTCTCATTAACTCATGCTGCCCCTGTCTCTTCCTGCCCTTTCTTCTTTCTCCCCC
CCCATCCCTCGCTCTCCCTCCTTCGTTTGCTGCGTTGGTTCAGATCCCTCTCTTGCTGCG
AGGGAGAGGCGGGGTGGTGGGGGGAGAGGGAGTGGGCGAGAGAACGGCCGTCTCTCTCTC
CACGGCGCTCCTCTCACCTCCCAGCGCTACCCTGGTGAGTAGTGTGTGTGGGTGTGCGCG
CGCACGTACGCTTGTGTGTCATTCAGTGGGCTTGAGTGGCAGCAGTGACGCTGGCTAATC
TCGTCTGTTCCTTCCTCTTTCTGGGGGGGTGAACGTGCACGTTGATGCGTTTAGTCTCTC
ACTCACAGCAAGGTGGCGACATTGAGACTTTAGAAAGTTTCCAAGTCGCTGATGAAAAGG
TGAAATCTCGTTAAGCCGTTATAGGTTCTGGGCCTTAGACTCAGCCCAGAGAGCTTCCTC
CTGTCTGGGTTCACGACTCCGTCACAGACTTCCTGGTGCAGGAACATCCAAACAAGCTAA
CGCTGATTTGTGACGAGAGGAAATTCCTCGTAGATCCTCAGTTGATGCCACATTTGTTTC
CTTTCCAGCCGGAGCGTACTACCCCGCACAGCCGCAGTACTCTCCGTCTGTCCAGCCGGC
GCCGGTCATGATCAGCCCCGCCCAGCAACAGCAACAAGCCCCGCCTCCCCAGCAACCACC
AGCACAGCCACAGGGCCCCCCAAAGAGGGAGCGCAAACCGGTACGGTGCCAACAAAAGGG
CTGTGTGAGGGTTTCAAAAAGGACTGGACAGAAAGCATTTGTTGGTTCAGTCCAGAACTT
TCTGGGACAACAATGGTGCTTCTGACGTGCAGCAGCAGCGCCGCACGTTGGAGGTAAATG
TTGCTTAGACACGTCCAGGTGATGTGTCCAATGTTCTCGCTCCAACAGATAAGAATACGA
GACCCCAACCAGGGGGGGCGTGACATTACCGAGGAGATCATGTCGGGTGGGAGGTCCGCG
ACCACACCCACTCCTCCACAGGTACGGAGGCTTTTGGGACCGCTGTCTTCTGACTCGGCT
AATCTGAACCAGTCGTGCTTCTGAATAAACAAACTCAAGGGTTTTGGTGCCGTTATCTAC
ATTTATATCTCCTTAATTAACTGTGACGCAGTAAAAGTGTTGTTTTGTGACCTCAGGCCG
CTGCCTCAGATGTAAGTCCTGCACACATCAATGGGGAAAGTACACATCCTGTTACTATGG
CGACAAGAAGAGGTACGTAAACCTTGTGGCCTACAGCAGAGACCTGCCAGTTTCCTTGTG
ACGTACAAGTGCTGCTGGTATTGTTACGAGGGTTGTTGATAGAAGCTGTGCTGTTATTAC
TATGAGTACATGTCACAAGTGTTCTCCATTTGTCCAGATGAAGCTGTGGAGCATCACGTC
GGTGCTGAAAACCCACCACCTCCACCCACAGAAAACCCAGAAGATCTGCTGGAGGCCAAT
CAGGACGCAGAGCCTCCACATGCGCCGCCTCCCGAGTTGGCTGCCCATCCTTTAGCAGAT
GCTGCTGAGGTGCCTCCTCCGTTGATGAAGGATGAGCAGGCCACGCCCTCCCTCCCCCCA
CCCACAGCCGCTGCTACACCTCCTCCTGAGGCGGAGAGCCAAGTGGAGGCTAAAGTTAGT
GACACTGTCGACGCTCCCGTTGTCCCTTCTGAATCACTAGCAAAGAAAGAAGCGCCCGTT
AAAATGGAAGAGCTCGATTCCAGCTCTGATGAGAAGACACCAGAAAAGGATGAAAGCAGA
CTGGAGGAAGTGAAGAAAGTGGAGGAGGACGTGGTCCCTTCAAAGGTAGGAGTGGCTGTG
GAGGATGCAGCGCTGGTTAACCCCGTTAACGTGGCAAAGGAAGAGACCACTGCTGAGCAG
CCAGAAGCCCAGCAGCCAGAAGCCCAGCAGCCAGAGGCCCAGCAGCCAGAAGCCCAGCAG
CCAGAAGCCCAGCAGCCAGAGGCCCAGCAGCCAGAAGCCCAGCAGCCAGAAGCCCAGCAG
CCAGAAGCCCAGCAGCCAGAAGCCCAGCAGCCAGAGGCCCAGCAGCTGGCGGCCCAGGTT
CCTGTTCAGCAGGTTCCTGTTCAGCAGGTTCCTGTTCAGCAGGCGGCCCAGCAGCCGGCG
GCCCAGCCCTCCGAGCTCCCACCCTCGGAACATGAACCTGCTGCTCCACAGAACCAGAGC
GCCACCCTCAGCCCCGAACTTGAACCTGAACCCACATTGGTTGAAGCCCCAGAGCTGCCC
CTTGCCAACGGCCTCCCCAGGGACACCGAGGAACTCCCTGAGTTGTCGTTTTCAGACACT
ACACCTCTGGAGAAGCCTGACGCTCACTCTCAGGAACCTGCACCTGTGGCTCAAACAGCA
ACTCAGGAGGAGGCGGTGAAGGAGGAAGACGGCCTGAAGCCGAGTAGGGACGACCCTCCA
GCCGCTGTTTGCCCCCCCACAGAAGAACCTACTACTATGCAACGTAAGATGCACTTGATG
TTTTCTGGTATTTGCTTCTCTTCCACGTACTCACGCACGTCCCTTTTCAGCTGCTACGTC
TGTGCCAAAGAAGAGGAAAAACATGAAGGAGCTGAACAAGAAGGAGGCCATTGGAGACCT
CCTGGATGCCTTCACAGAGGTGTTTTATCCAGCGGGCTGGGTTAAAGCGTCTCGGCAGAT
TCAGCTAATATCGTTCTGTTCTTCTCCAGGAGCAGATCAAACCTGCTGCTGAAGCGTTAT
CCACTCAGGCCAGCCCCGTCCTTGATGCTCAGGAGGAATCATCTCCCTCGGAGGCTGCAG
ATGAGACCTGGGAAGAGAAGGAAGACAAACACAGTGGTGAATCTGATGGGCCTAAACCTG
CCCCTGACCCAGCTGGGCAGAAACACCAGTCCAAAGAAGGTAGTAGCACCCAATGTTGAC
AGCGTTCTGCTGTAAATACGTAAAGGTGTCGATTTCCACACCAGCAGCTCGAGTGGCAGA
ACTATCCAACATGGCCTACTTTACTGTTTGTCTTAGAAGAAAAGTCAAATGACCAAGACG
ACAAGAAGCGCTACAACAGGGACTTCCTCCTGGGGCGCCAGTTTCTCGGGGTCAGTATGC
ACAGACCCGAAGGCCTGCCGTCCATCAGCGACGTGGTCCTGGACAAGGTAGCAATTAGAC
ATCCTTCTGAAATTAAAAGGAGAGAAATTGTCTTTTTTCTAAGCTGGTCTGTATTTCTAG
GTGAACAAGACTCCGCTGCGTCCCGCTGACCCGGCAAGACTGATGAACGTTGGGCCGGAT
TTTACGCCCTCGTACTTGGGGAACCTCGGGAGCCGATCAGTGGGAGGACCTCGAGGGCCA
GTGCGTAAATCTGTTTTTTTCTCCTTTATTACAATAAAAGCCACATCAAAAGATTTCTCT
CTTGGATGTTGGTTGCCTCCATTTAAACCTTGTCCTCCTTTAGCCCCCGGGGCCGCGGCG
CTCTCAGCAAGGTCAGAGGAAAGAGCCGAGGAAAATCATCAGCAGCATGTCCCTGAATGA
TGACGTGCAACTCAGCAAAGCAGAGAACGCCTGGAAACCCTCCAGCAAGAAGTCGGCACG
CAGCCGTGCTGCTGAAGACGCCGAGGAGGATGGCCTGGAACAGTCCAGGACCCACGAGGT
GCTGAAGCAGCTTCGTAGTATCCTCAACAAACTGACACCTCAGAAGTTCCAGGCGCTGAT
ACAGCAGGTGAAAGAGCTGAAGATCGACACGGAGGACAGGCTGAAGGGAGCCATTGACCT
CATCTTTGAGAAGGCCATTTTGGAGCCCAACTTCTCCGTGGCGTATGCCAACATGTGCCG
CTGCCTTATTGGAGTAAGTCTGCTCAGATGCACCATAATCACGCACGTTGTTGCTGGCTC
CTGTGATGACTGATGCTTTGTGCCACGTGTCTGGGCCACTGAATGATCGTGATGGCTTTG
AGGATCTGATGGAGCCAAATTAAAGCACTTGACCCACTTTCTGCTTAAAACAAACATTCT
GACACCTAATAAAGTCTTTTCCTTCTCCTCTTCTAGTTGAGAGTGAACACAGAGAAGCCC
GGAGCTACTGTGAACTTCCGCAAACTGCTACTTAACCGCTGCCAGAAAGAGTTTGAGAGG
GACCAAGATGATGACGAGATCTTTGAGAGAAAGCAGAAAGAGTTGGATGCTGCCAAAGCT
GTAAGCCTGAGGTTTCACTGCTGCCACAGGCCGCCATGTTTGTAGCACTCACACACACAC
ACTCACTCACACACACCTGCTTGTATCCGCCCTCAGGGAGATGAACGGGATCGGTTGAAG
GCGGAGCTGGACGAGGCCAAAGACCAGGCGCGCCGTCGCTCGCTCGGCAACATCAAGTTC
ATAGGCGAACTTTTCAAGCTGAAGATGTTGACGGAGGCCATTATGCACGACTGTGTGGTA
AAACTACTGAAGAACCATGACGAAGAGTCTCTGGAGTGCCTCTGCAGGCTGCTCTCCACC
ATTGGCAAAGATCTAGACTTTGAGAAGGCCAAGGTAAATGAAGCACCACAAACCCTGGTG
TCTTTGAAGTGTCTCTGGCATCTCGGTGTGTTCTTTAGAGGTTAGCATAGCGTAGGAGAT
GCTGTCGTGTTTAAACCTTGTTGGTGTTCCTGCACAACAGCCTCGGATGGATCAATACTT
TAATCAGATGGACAAAATCATCAAAGAGAGAAAGACTTCTTCCAGAATCCGCTTCATGCT
ACAAGATGTGTTGGACCTCAGGAAGGTAAAAAGTGACACATTTCAACGTGTTCAGCAGCC
AGTTTCCCCCTGATTGATGACGATATTTGGACCAGTTGTCAAGTAGCTTCTGTCTGTGAC
CTTCAGAATAACTGGGTGCCTCGACGAGCAGACCAAGGTCCCAAAACCATCGACCAGATT
CACAAGGAGGCTGAAATGGAGGAGCAGAGGGAGCAAATCAAAGTCCAACAGCAGCTCCTG
TCCAAGAAGGACGGAGGAGGCAGGATGGGAGGGGGCATGGGAGGCCGGGGTCCTCATGCA
CAAGGAGGGGGCAGGACCAGCCAGCCTCAGGATGAAGGATGGAACACAGTGCCTATCTCC
AAGAACAGACCTATTGATGCCACACGCTTTAGTAAAATCACCAAGGTAGAGGTTGCACCT
ATCGGGGGGGTTGACACCAGTCCAGCTCAATATTTAAGGGCTTTTCAGAGTTTGTTTCAA
CGACCTCACGTCTGGTTCAGCTGGTTAATATATAAATGTGTCGCTCTTGCTTCAGCCGGG
CGCCGTAGATGTCAACAATCAACTCTTGGCACCGGGGGGCAAAGGCACCTGGGGTAGCTG
GGGCAAAGGCAGCAGCGGAGGAAGTGGAGCGAAGCCAGCAAGTGGGAACAAGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGCAGCCAGACCCGCCTCACCAAGAGGAGCT
TCAGCAGAGAGTCCCAGGACCGTGGCAGCAGGGGCCGAGACAGCCGGGATGCTAACGAGC
CTGTGCGTCGCGTGGCCAGCATGACCGACAGCAGGGACCGGGGCAGCAGGGACCGGGGCA
GCAGGGACCGGGGCAGCGCTGACAGAAGGCCCGGCAAAGAGCTCGCAGGCGAGTTGTCCA
AGGAGAGCAGCACTTCTTCAGAAGATGGAGTTGATGGACGTTGAAAAGATGTTGTCTTTT
GCTCCCCCCAGTTAAGGGAGAGAATGCCCCTACTCCCCCCCCTCCCAAACCTGCCATGAC
AGAGGAGGAGGTAGAGAAGAAGGCCAAAGCCATCATTGAGGAATACCTCCACATCAACGA
CTCAAAGGTACGGCTCGATTCTTTCTCCTCATCTGGCAGCTGATTGAGAGGATGTTGTCG
TCTCCTCCCGCCACAGGAGGCGCTCCAGTGCGTCACGGAGCTCAACAGTGCCTCCCAGCT
CTTCGTGTTCGTCCGGTGTGGCGTCGAGTCGACCCTGGAGCGCAGCACTCTGGCCAGAGA
GCATATGGGGAGGTTATTGCACAACCTAGTAAAGGACGGCATACTGGCCACACAGCAGTA
CTACAGAGGGTGGGTCCAGCACTGTGGTGCACCTTGGTGAGCACCAGGCCAGAGAGAATG
AGCCTTGTTTTCTCTCTCTAGGCTAGAAGAGACTCTGGAGGCTGCAGAGGACATCGCCAT
CGACATCCCTCATATCTGGCTCTATCTGGCAGAGCTCATTACCCCCATGCTGCACGAGGG
CGGCATCCCCATGGGACAGCTCTTCAGGTGCTCCAGCTTCATCCACACTCGTGTTTACTG
GTGTTTGCTTGACCCACTGACTTGTGTCAGATAAGCTCTTGCTGACACCCGAGCACATTC
ACGTTTCATGTCTGCTGGCCCAAAGATTGGAGACTCACACTTGATGAGCCTGGACTGAAG
TTTGGTAGAAAAAGATGTTTCCACACAGCTAACTGGTCCATTCTGCCTGTAGGGAGATCT
CTAAACCTCTTGTGCCTCTGGGGAAAGCCGCAGTGCTGCTCGTGAAGATCCTCAAGTTGC
TCTGCAAAGGGATGGTAAGTGCAGCATCCGCCCGTCCACCGTGAGGATGGAAACCAGTTC
AGCTGGGTCGGATTTTAAAGGCCATTGGAACAAGTTTACTCTTTGTTCCCTCAGACTCCA
AAGAAGGTTGGAGCCATGTGGGTCGGTGCTGGGCTGAACTGGAACGACTTCTTGCCTGAG
GATCAAGACATGAACAAGTTTGTGACCGAGCAGGTGAGCAGGACGATGTGCACCAAACGC
CGTGTCCAGCTGTTTTTGGGTTGCTGATGGAAACACTTGGACATTCAGACGCTCGTTTCC
ACACACGTTCCCGCCTCAGGCAGAAGGCGCCATAACCTGCCGTGGTTGTTGTTCTGAGCA
GGAAGTGCACGTGCACGAGTACAGGCCATGGGTGAACAGGTCTGGGGCAGAGTTGTGATA
TATGTACCGTATTTTCGCGACCGTAAGGCGCACGTATTATCAGGCGCATGCACACATACA
GTAGAAAATGACAACGGAAGTAAAACAGTGAGTTTCGACACATTTATTGAACAAAATATT
CATTCTTCCGCCACAAAACCATCAAAGTTTTCATCTTCTGTATCTGAATTAAACAGCTGC
ACTATTTCAATGTCCAACATCCCCAATTCCTCTTCTTACGCATCTCGCTTGACCGGCGCC
ATTTTAGGGGGTCCTGACGCGGAGGTGTGCCGCTAATCGATGGGCGGAGCGTTTACCGTA
GTGCACCCACCAAAGGGGCACAGCAGATTCTGGAACTCAGTCCACACACAAGGCGCTCCA
TATTATAAGATTATTATTATAAATCTCAGTGTTTTAGGTGCCTTATAGTCGTGAAAATAC
GGTAATCTGAAATATACCCAGGTCACCAACCAGTCCAGCCCCAGTAAAGCAAGAACATCT
AAGAGTGAATGATGTCATAACCTTTCCTTCTGGTCCATAACTCAGGAGGTGGAGTTCACT
CTGGGAGAAGAGACTGAGTCAGCAGAGGTTGGGAAGAAGGTCCTTAGTGGAGCAGAGCTG
AGCAAGGAGCTGGACCAACTCCTGGAGGACGACGCCAGCAACCAACGGATCACCGACTGG
GTGGAGGTGAGACGCTGCTGCTGCTACTGGAGCTGCTGCTACTGGAGCTGCTGCTGCTGC
TACTGGAGCTGCTGCTGCTGCTACTGGAGCTGCTGCTGCTGCTACTGGAGCTGCTGCTGC
TGCTACTGGAGCTGCTGCTACTGGAGCTGCTGCTGCTGCTACTGGAGCTGCAGCTGAGCT
GCTACTGGAGCTGCAGCTGCTGCTACTGGAGCTGCAGCTGCTGCTACTGGAGCTGCAGCT
GCTGCTACTGGAGCTGCAGCTGCTGCTACTGGAGCTGTAGCTGCTGCTACTGGAGCTGCT
GCTGCTACTGGAGCAGCTGCTGCTGCTACTGGAGCTGCTGCTGCTGCTACTGGAGCTGCT
GCTGCTGCTACTGGAGCTGCTGCTGCTGCTACTGGAGCTGCTACTGGAGCTGCTACTGGA
GCTGCTACTGGAGCAGTAGCTGCTACTGGAGCTGCTGCTGTAGCTGCTACTGTAGCTGCT
GCTGCTGGAGCTGCTGCTGAAAATGATGAAAATCAGGCAGAAACTGACAGAGCTGCTGTT
GATTTTGTCCTCAGGCCAACTTGGACGAAGCACAAGTGGCCTCCAACCAGTTCATCCGGG
CCCTGATGACGTGCGTGTGTCAGTCTGCCATCGTCTGTAAGTACCTGGCAGGAGGTCCCA
GTAGATGTCCCATCTTACCTGAACACGCTCTGCTGCTCTCTCCAGGTGTCAACACGTACA
AGGTCAACGCCCAGCAGATCAACAAGAGAGCCGCTCTGCTGCAGAAGCACCTGTGTGATG
AGCAGAAGGAGCTTCAGGCCCTGTTTGCTCTCCAGGCTCTCATGGTGCACATGGAGCAGC
CGGCGAGTGAGTCTGATCTGCCGCTGAGTCAGGACTGGGGATCTAAATAGGGGGGGGGGG
ACACCTGCAGAGCGCTGCCAAGGAACCCTTGAGCAAGGCAGTAGAGCCCTGCAGTGACCT
GGTGGCTCATCCAGGAGGGTCGCTGGAGCTGTTGGTCCTTGTTTAGGAATGATTTTTGTT
AATTTCTAAAAAATGTGATCATCAGTGGTTTGAAGTTTAGTTGCCCAGAGAGACGAGAGG
TCCAGTGGTAGGTGGACCCGGGTCAGATTTGTCCTGTGATCATCTCAGAATACGTCCCTC
CTTTGTGACCATTTTGTTGTGCCAGAACGCCCCTCAACACCTGTGTTGTGTCCCCTGCTC
ACAGACCTGCTCCGGATGTTCTTCGACGCCTTGTACGACGAGGACGTCATCAAGGAAGAA
GCTTTCTACAAGTGGGAGTCCAGCAAAGACCCTGCAGAGCAAACAGGAAAAGGTGTGGCC
CTCAAATCAGTCACCGCCTTCTTCACCTGGCTGCGCGAGGCCGAGGACGAGTCGGACAAG
GAGTAAGGAGGCGGGGCTGAGGGCTGCCCCCCCCCCCCCCGGGGGTGCAGCCCTGGAGAG
GAAGACTCATCAATCCTCAATGAGGATGAATATTTCTCTTGCTGTGAGGGATGGACTTGA
ACCCACTCATCTCTCGGTCCCTCCCTCTCACTTCCTCATTATTTCTAAACCTGCGTGTGA
TGGGGGGGAGGTCCTTAACCCCCTGGGGGGGGGGCGTTAACCCGCTGCCATAAGAGCCGC
GTCACTACAAAACGTTTCTGTCTAATCGTACAAAACCAGCAGGCTGCTTCTTATTTTTCT
ACTGGGTGTAGACGAACTTGGAGCCTGCGTCAGACCTGAGGCTAACAGCAGAGCATGTGA
CCTGAGCGTTGGGCCCCGCCCACACCTGCTTGAACTTTGACCTTTACGGCAGCATGCTGC
GAAGCTGAAGTGCTGCTGGGCAAACGCAGAAACTTGTAGTGATTTGATGGACTTTTCGAA
GCAGATTTTGTTCCTCCTCCTGTTTCCCATCATGAACTTAGAGGACAAAACAGAAGACTG
ATGATGACCTTTGACCTTGACTACTTGGGGGTGGTCTCAATGCTTCCTCAAAGCCATCCT
CTCATCCCCAGTAGTGACCCTAACGGAGGGACTCATTGTCTTTACCTCTTATTTAACTGA
ACCTGAGCTGACCTAGAGGACACGTAATGACCCGATCATCATTAAAACTTGAAATCTACA
GAAAATTGACTTGATTATATATTAAAAAAACAAAAAAACAAAAACAAAGCAGAAATGATC
TGAAAGCCTTTTCTACTACAAGTGGAAACATTTCAGGAGCATTCTGTAAATGTATATTGC
AAAAAACAGTTTTTCTTTAGTTTTATTTTTCAGAAATGATAATTGCAGTGTGACCTTTTC
CAACAGAAGCCGCAGTTGTCCGGATGCAGAGGGATGCTTTAGATGATCCAATCATTATTA
GTTGTGTTGGAATTTTGTAAATATTCTCATTTTTTCTTTTTTGCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1078, 1253..1339, 1880..1900, 2128..2304, 2417..2516, 3548..3699, 3888..3984, 4357..4663, 4703..4958, 5082..5442, 5510..5598, 5669..5858, 5976..6106, 6180..6299, 6403..6792, 6996..7139, 7236..7472, 7600..7704, 7806..8084, 8215..8326, 8787..9038, 9071..9186, 9256..9428, 9501..9626, 9832..9913, 10014..10112, 10845..10985, 11534..11615, 11685..11825, 12184..12365
1001..1078, 1253..1339, 1880..1900, 2128..2304, 2417..2516, 3548..3699, 3888..3984, 4357..4663, 4703..4958, 5082..5442, 5510..5598, 5669..5858, 5976..6106, 6180..6299, 6403..6792, 6996..7139, 7236..7472, 7600..7704, 7806..8084, 8215..8326, 8787..9038, 9071..9186, 9256..9428, 9501..9626, 9832..9913, 10014..10112, 10845..10985, 11534..11615, 11685..11825, 12184..12362
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved