Takifugu_rubripes Locus NACA2
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes NACA2
Takifugu_rubripes
NACA2
scaffold_257
SNORD59
1817..1889
4006
AGAAAAGGCTAAAGCTGCTCCTGTTGAGGCAGCCAAGCCAGCAGAAAAGGCTAAAGCTG
CTCCTGTTGAGGCAGCCAAGCCAGCAGAAAAGGCTAAAGCTGCTCCTGTTGAGGCAGCCA
AGCCAGCAGAAAAGGCTAAAGCTGCTCCTGTTGAGGCAGCCAAGCCAGCAGAAAAGGCTA
AAGCTGCTCCTGTTGAGGCAGCCAAGCCAGCAGAAAAGGCTAAACCTGCTCCTGTTGAGG
CAGCCAAGCCAGCAGAAAAGGCTAAAGCTGCTCCTGTTGAGGCAGCCAAGCCAGCAGAAA
AGGCTAAAGCTGCTCCTGTTGAGGCAGCCAAGCCAGCAGAAAAGGCTAAAGCTGCTCCTG
TTGAGGCAGCCAAGCCAGCAGAAAAGGCTAAAGCTGCTCCTGTTGAGGCAGCCAAGCCAG
CAGAAAAGGCTAAAGCTGCTCCTGTTGAGGCAGCCAAGCCAGCAGAAAAGGCTAAAGCTG
CTCCTGTTGAGGCCGCCAAGCCAGCAGAAAAGGCTAAAGCTGCTCCTGTTGAGGCAGCCA
AGCCAGCAGAAAAGGCTAAACCTGCTCCTGTTGAGGCAGCCAAGCCTGCAGAAAAGGCTA
AACCTGCTCCTGTTGAGGCAGCCAAGCCTGCAGAAAAGGCTAAACCTGCGCCTGTTGAGG
CAGCCAAGCCTGCAGAAAAGGCTAAAGCTGCTCCTGTTGAGGCAGCCAAGCCAGCAGAAA
AGGCTAAAGCTGTTCCTGTTGAGGCAGCCAAGCCTGCAGAAAAGGCTAAACCTGCTCCTG
TTGAGGCAGCCAAGCCAGCAGAAAAGGCTAAAGCTGCTCCTGTTGAGGCAGCCAAGCCTG
CAGAAAAGGCTAAAGCTGCTCCTGTTGAGGCAGCCAAGCCTGCAGAAAAGGCTAAAGCTG
CTCCTGTTGAGGCAGCCAAGTCCCTGGATAAGCCTAAACCTGCTGCAGTCGAGGCTACTA
AGCCTGTAGAAAAGGCGAAAGCTGCCCCTGTTGAGGCCACCAAGGCCACAGAAAAGGTCA
AATCTGCCCCTGTTGAGGCTGCAAAACCCGTAGAAAAGGTGAAAGCTGCCCCAGTTGAGG
CCACCAAGGCCACAGAAAAGGTCAAATCTGCCCCAGTTGAAGCCACCAAGCCAGCAGAAA
AGGCCAGACCTGCTCCCATTGAGCCTACTGTTACTGCTCCAGCCCCACGTAAACTTACAT
TTGCAGAAGCCGTTTCAAAACCTGCCCCTGTCACAGCTGAAGTTGAGGTAATTGGTACAA
AACCTTCCGAACCCGTTCCATCACCCAAACCTGTCCCTCCACCTGTTAAAATCCCAGCCA
CACTGGAGCCTGTGATCAAGAATGATAAGGGTATTCCTTTTCAATTGTCTTGTGTGAACA
ACTTTTTGGAAGTGCTTTTAGCTGTTCAGTAGCACGTTATCTTTAAATCTTGTGGTTATA
TCTTTAAAAGTTGTGGTTGTTTTGATTCCTTGATGTTGGTGTTCTGCTGGATGAGTTGTG
GAAGAATAGATTGATTTATCTTTGGGTTCAAGTTAGCTTGATATTAATGGGGTTCTTATT
ATTATGGGCCTTATCTTTAATGATTTCTCCCTATTTTTATTCCGCAGGATTAACCAAAGG
ATTCAACTGAAAGCCTATAAAACAATTTTGATTTTTTTTTTCTTTTGTCTAGGGTCCGGA
ACTGAATCAGACAGTGACGACTCTGTCCCAGAGCTGGAGGAACAGGACTCCGCACAGACA
CAGACACAGCAGGCTCAGGTAGACTTTGAACTGTTCCCTTCTGACCTTAGCTGAGACATG
AAGTAATGAAACTCACCTCTTCTGTGATGATCAACACATTGACTTTCGTTCTTCTGAGTG
TACTGAAGCCATCTTTTTGTCCTGAGAAGACTGAGAATTCCATAAAAGGATATTTAAACC
TGGGCGATGTGTGCAGTTGAATGTAAGGGATGTGTTTGTTATAGCTGGCAGCAGCTGCTG
AGATTGATGAAGAACCCGTCAGCAAAGCCAAACAGAGCCGGAGTGAAAAGAAGGCACGAA
AAGTGAGTCATTTTCCACTTTACCCCCTTTTATGAATCGACTTATGTGACGGGCAAATTA
TTTAAATCCTTTTCTTTCTTACAGGCAATGTCAAAGCTCGGTCTCAGGCAGGTAACGGGG
GTCACACGAGTCACGATTCGCAAGTCAAAGAACATCTTGTTCGTCATTACCAAACCAGAC
GTCTACAAGAGTCCCGCGTCAGACACATACATCGTCTTTGGTGAAGCTAAGGTACTCGGG
GAAAACCCCAACCTGGGCCGCTCTTGAAGGAAAAACCATCCTAAATGACATATCGTCGTT
AATGTTTTGCTCGCCACGCTCTAGATCGAAGATCTTTCCCAGCAAGCTCAGCTGGCTGCG
GCAGAGAAGTTCAAGGTCCAGGGAGAAGCTGTATCAAGCATCCAGGAAAACACACAGACG
CCAACAGTACAGGAGGAGAGCGAAGAAGAGGAGGTAACGCGCCGTCGTCACGCAGGCGAG
GCGGAGACAGACGGGCGTGCACATTGGTACCAATTCTCTTTTCTGATGATAGGTTGATGA
GACCGGCGTTGAGGTCAAGGACATCGAACTGGTCATGTCACAAGCCAACGTGTCGCGGGC
GAAGGCAATACGCGCCCTGAAGAACAACAACAACGACATCGTCAACGCCATCATGGTAAG
AGTTTGTTCTCTCTGACGGCTCCTGGTCTCTACAAGTCCACACAGCTCTTCAATGAGGAT
CCCAACATTGACTTTCGTTCTTCTGAGTTTCATGAAGCCGATGTTTTCGTACTGAGAATA
GAGCGATTCGTTGGATTTTTGTGGAGAACTTTGTAACAAATGTACTTGAACCTATTTTTG
TGCTCTCTTGCAGGAATTGACGATGTAGGGGGACTCTGGAAGAGCCGGGGTTGAAGAAAG
GTTGCTGATTTAAGCTCATTTATACAATTTATTATACCTGAGGTGGAAATAAAGATGTGG
CTTGATAAATGAAATGCTTTTATTTTTTATTTTTCTGCACACCTTTGGGGGAAATGGGCA
GTTGCAGCGCAGCCTTGGACAAAATTCAAAGACGTCAACAGTTAGTTCCAACCATCCATT
TACTGGAAATATATCACAACTCTGGAGGACATTGGAAGGGACCAAGGTGAAATGCTGAGT
CCATTTCATCGAATTTATCCCTGGTTTATCAACTGATAATCAAACACTACAATAAAACTT
TTCCCACAATTGTCTTTTAAAATGTTTAAAGTCTTCAAGAGCAACTTAATTCTGGTCTGG
GGGGAGGTGATTAATTTTATTATTGAACAACCACCATGTTCTTAATGAACCCAAAAGACT
CATTAATATCAAAGCTGAATATTTTTGGGAGTTGGAGTGGGGCTTTTTTAGTTTTAGCTA
TTTTAGGAGGATATCTGTGTGCAGGTATTACTGTGCATAATTATTAGGCAACTTAAAAAA
CAAATCTATACCCATTTCAATTATTTATTTTCACCAGGGAAACCAATATAACAGCTCAAC
ATTCACAAATATACATTTCTGACATTCAAAAACAAATCAGTGACCAATATAGCCACCTTT
CTTTGCAAGGACACTCAAAAGCCTGCATGGATTCTGTCAGCAACCACAGCCTCCCAGACA
CTGTTTCCCCTCCTTGTAAATCTCACATTTGATGAGGGACCACAGGTTCTCTGTGGGGTT
CAGATCAGGTGAACAAGGAGGCCATGTCATTAGTTTTTCTTCTCTTAGGCCCTTTCTTGC
CAGCCACGCTGTGGAGCACTTGGATGCGTGTGATGGAGCTTTGTCCTGCACGAAAATCAT
GTTTTTCTTGAAGGATGCGGACTTTTTCCTGCACCACTGCTTGAAGAAGGTGTCTTCCCG
AAACTGGCAGGACTGGGAGTTGAGCTTGACTCCATCCTCAACCCGAAAGGGCCCCACAAG
CTCATCTTTGATGATACCAGCCCATACCAGTACCCCACCTCCACCTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1057, 1668..1757, 1964..2041, 2124..2270, 2364..2492, 2572..2694, 2893..3006
1001..1057, 1668..1757, 1964..2041, 2124..2270, 2364..2492, 2572..2694, 2893..2904
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved