Takifugu_rubripes Locus RPL7
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes RPL7
Takifugu_rubripes
RPL7
scaffold_234
SNORD12
3423..3513
5198
AAGTAGTGTACAAGCGAGCACCCTAACTCGGAAAATGTATCTCATCAGCCTTTATGGTA
TCACGCTGATTGGATACATTTTTTATCGTAATTTCTACTGTGCGGTTTGATATATGAAAT
TTTTGGAAATGAGAATTTGTTTTCAGTAGGTGTCCAATATGATCATCTTAAAATATTACA
ACATAAATGTGTTAAAAAAAAAAAAAATCAATCAATCTTCACTGATCCCCCCACCTCTCA
CTTAAAATTGTTCTTTGGAATCGTCTGTTCCTCACCAGGTGACAGAATCTCAGTAAAAGA
ATATTTACAAAGTAGCTCTGGATCCATTTTTTGATGAAAAATTGCTTTATTAAATGTTTT
CACTACAGCTGAATATGACTTGAGAATGTGTCATCACGTCTTGGCTTGAAAATGTCAAGG
GACACTAATTATTTTAGGTAATAAGTAATTATTATTGACATTAATATTTCATTTTATTAT
ATAAAGCTAATTATCGGGTGAAACATTGCATTTTCATAAAATGACCGCTGAATGTATTTG
TGATGGGTTAAAATAATTAAATGGACCTGGCCACTTTTCACGGCGACTGGTTCGTAATTA
TTATGCGACACATGACGTCACTTTACGTGCGCCGTAAATGACGCCGTTGTCCGAATACTA
ACTTTAAACTTAGTGCACTACGTAGTTCACTCAATCCATGTCCCCCATGTCGTGATTAGT
GAATAGGGAACGTCTCTCGACTGCTCTGGGAACGCCTGGGGATCCCCCCGGATGAGCTGG
AAGAAGTAGCTGTGGAGAGAGAAGTCTGGGTTTCTCTTCTTAGGCTGCTGCCCCCGCGAC
CCGACCCCGGATAAGCGGTAGAGGATGGATGGATGGATGGATGGATGGATGGATGGATGG
ATGGATGTTAAACGACAATTAACATTTCGGTCAGGCACCTACAAGGACAGACATCAGGGG
TCCTACGTCCTTTAACGCGCGCATGCGCGGAGGAAAAATTCTCTTTCTCGGTGGACACAA
TGGCTGACGCAGAGTGAGTGTTTGCTGTCACATTAAAATCTATTCACATCCATCGCAGAA
ATGATCAGTGTTGATATTTCTGCCTCGTATATTGGTTGTCTGTTTTGTATATATTATTAG
GTTAAAAGTATTGTCAAGTAGTCACTTTGAATTATTTATCACTAGCGATTACACTTACCT
GAATGTTAGCTGTTGAGCAACATGGCCGACTCCTTGACTGTGTGTACTGCAATTAGCTTG
TTTTTAAGAAGGAAGCATGGTAAGAAACTACACTTTAATGTGCATTTAATAGCACTTTGA
TTTAAATATCCAGCTTAGAATGGAGGAAAACGAGACGGTTGAATGGAAACGGGGCGAGGA
CCAGTTATTAATGTAGCCGTGAGCTTCATGAGGCGATGAGTTGTCAGTCCTACAAAGTCC
ATCCATGCGAATGTTTACCATCGCGTTGGTGACTTGTTTGTCTAAATGTTGGCGTTTCTG
AAACAGTAAAGTTCCGGCGGTCCCTGAGAGCCTTTTAAAAAGGCGAAAGGCCTTCGCCAC
CATGAAGGCCATTCGAATCAAGAAGATGCTGGCCGCGAAAAAGGTAACTTGAACTGAATG
AATCTGGCGGCGGTTTATCTGGATCAGCACGTTAAAATGTTTCTATTTCCAGGCCCGTAA
AGTAAAGAGGAAACTGATCTTCAAGAGGGCTGAGAAGTACCACAAAGAGTACCGGCAGAT
GTACAGGCGTGAGATCCGCCTGAGCCGCATCGCCCGCAGGGTGGGAAACTTTTATGTTCC
AGCTGAGCCCAAACTGGCCTTTGTTATCAGGATCAGAGGGTAAGACCCATGTTGCAAAGA
CACATTTTTTTAAATTCTGAATTTACGTGGATTGCTAAGATGTGAACAGCACAAACTGCC
AGTAACACGTGGTGACTGAAGCATCATTATCTGATGGAAGATGTTGTGATTCTTAATGAT
TTTGACCAAGATGGAGTCTTTAAATTGTCTGACAAAATCACATCACCATTTTCAAATTCA
TTCTTTCCTGGTTGCCTTTTAGTTTTGAATATAACGATCCATGTAAATGTCTGAAATGTT
TTTGTGGTTAATGATGTGCTCTCTTTCCCCAACTTATCGACTATGGTGATACGCTCATAC
TTAATAAGCCAAATATTGCTGAAACCACAGTGCACTGCTTTGTCAGAAACCTGTATGTTG
ATGCATTCAGCTAATACTTCTATCATCTTTTCTAGTATCAACGGTGTCAGCCCAAAGGTT
CGCAAAGTTCTGCAGCTGCTGCGTCTGCGCCAGATCTTCAACGGGGTGTTTGTCAAGCTG
AACAAGGCCTCTATCAACATGCTCAGGATTGCCGAGCCTTACATTGCTTGGGGGTAAAGC
TCTTATGAAAGCTTCTCCATCATGTTGCTGAATTATTACTCAGAATAACTGTTCAACATG
GGCTGGCAGCACAGCGCACTGCTATCAGTCATGAGTGTGGTTAATGATGTCAAACTTTTT
TCCCCGGCTTATCGACAATGAGGAGTCAAAACCATTTCAAAGCCAATTGTCTGAAACCAC
ATTCTGTGACATTGATGGCTGCCTCTCATTTGGTTGAGTTGTGTAAATGTAACAGTTCAG
TAAACTTTTGATTATTTAAAGGTTGAATGGAACTAAAATTCATATGATCCCAATTGATGG
TAACCTTTGTCTGGTACCATGAGCATAAATCCAGACCGCATTTGTATCATGACTTGATTA
GGCACAGAATGGACCAGGACATTCTCAGAAGTTACGGTAAGAGGATGCTGTGAAATATGT
CCATGAGCAAGCTATGCTGTTGGAGTGGTATTTCCTGCTACTTATGTCATTGTGGCTATT
ATAGCTATTATAGCCTGTAGTAGAAAAACACAAACAGCTGTCATCAATCCGTGTCTAAGG
ACCATCATCAGTCAGGCTTTCTGTCCAACCAGAGACACCAGCTTTTACCTATTGTCCCAG
TTTCCTCTGAGGGTTGTTAACCTGGTTGGACAGAAAACCTGGCTTTTATATTCACAATCT
AAGTGTGACAATTTTTCATGAGGACAAGGGACTTCCTGTCAAGATGCTACTCACAACAAT
TCTTGATGGCTTGTTATTTTAAACTAACGCATAGTTGCTATTTTATCAGCTATTGAGCGC
CTTTCTTCCCCCCCTCCCCCCAGCTACCCGAACCTGAAGTCTGTGCGTGAGCTTATCTAC
AAACGTGGTCATGGCAGGATGAGGAAGCAGCGTATCCCCCTCACAGACAACGCCCTGGTG
GAGAAGGCTCTCGGTAAACATTTTATTTTACTTGAGTAGCTACAAATGGCACCAGTATAG
AGGTGTCTGATGCAAAGAACATCACTGGTAACTCCTGGTACTGTTGGGTTTAAGGCAGTT
CTACCTGTGGTTGATGATGCAAGCTTTTTTCCCCATCTTATCGACCATGGTGAAATAACC
TGAAAACTAAGCCAGTTGGGTCTGAAACCACATGTATTTCCCACATTAATTATTAGGGTT
ACAGTCAGCCTTAATGCCACTATCCTTGACTCATATTTCCATATGAAGGGGAAAATCCAA
ATTTGTAGCCTTTCTGCTCTTCAGTTAACACATTGGACTTGATTTTCAGGCAAATATGGT
ATCATCTGTGTTGAGGACCTCATTCATGAGATCTATACCGTTGGAAAGAACTTCAAGCCT
GCCAACAACTTCCTGTGGCCCTTCAAGCTGTCTTCACCCCGTGGTGGCATGAACAAGAAG
ACCACACACTTTGTGGAAGGTGGAGATGCTGGCAACAGGGAGGATCAGATCAACAGACTG
GTCAGGAGGATGAACTGATGTATTGGTGAGTGTTGAGGTCTCGGTCATACAGAACCTATT
TGATGTGGTTAATGATGCATCTTCTTTCCCTGTCTTATCGACCATGTTGAAAGCCAAGGT
CTACATTTAGCCAAATGTCTGAAACCACATCTGTTACATTTGGAGTTAACCTTAATATTT
TTTCACTCTTGGGTTATGATTTGATTTAAATCATTTGTGTATTTTACTTGAACGTTGCCT
TCAAGTATATAAGATAACTTGAAATCTTTAGTCATCAAGAACATGTTTTTACCTTATCTT
ATGAAGTTTGGTTTCCCCCTGTCTTTCAGGTTTTCTAAGGACATAAATGTACAATAAACA
TTTAAAAAGTCTATCTTTGTCCTGTTGTTACTATGTCTTTTTTACAGAAACAGTTTTTAT
ATACAGGTTTAATTTAGGTGAAAATAAATAGGTTACAAAATCATAATAGGATGGTCAATC
AATCTTGATTTATATAGCATCTTTTACAATCAAAATTGTTTCTAGGCGCTTTACAGAATC
CCAGGGCCTAACCCCAAACAAGCAACAGTGGCAAGGAAAAACTCTCCTTTTAACAGGAGC
AGGACTAGGCTCATGTAGGGGGGACCCTCCTGCTGATGGCCGGTTGGGTAGAGAGAGAGG
AGAAGGGGGAGGACGGGTAGAGGAGAGAATAGGCATAGATCATACAATACATATGAAATA
CATTATATTAAGTAAAGTAAAAGGTTCTAAGCCAGTGTAAAAACCCTTGGCTCCAATATT
ACATCAAACAAATGTAAATCTGCTAAATATTTGTTCTGGGGAAATGGGGAATTCCTTACA
TATTTTATGTAACAAATGCAATTTGCAAATTTGATTCCAACATTTTTTGGTAATACCTGT
TATTCAAATCTCTGAGTATACAAGTCAATAAAGATGAATTGAACTGAATTAATGTAGGTG
GACCCTCCTGCTGATGGCCGGCTGGGTAGAGAGAGAGGAGAAGGGGGGAGGACAGGTAGA
GGATAGAATAGGTAGGAGAGGGGAGAGGCAGTCAAAGCAGCGTTGGTTTAGGGGATTATC
GGTGAATCCAAGGGCATTGTGGGTATTGGCTGTGAAGTTTAAAAAATGGATTCTGACAGT
TTGGCTTTAAGTGTTGTTGTTTATTTTACTGACGCTATTTGCAGGATTTCCATGCTGTAC
ATTTTAATTTTCCTGTACCGAACCTTTCGTAGAACGGGTTGTATAAAACCTGTTACCATG
GCGACGTATTAAAGCCGTTAGCGTTAACCACGGTCAGTGCTAGCACTGCGGCTCTGGATC
AAATTATGGAGCCAGTCGAGTCTTCCATCTGCTATGAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1032, 1500..1602, 1672..1838, 2255..2392, 3203..3312, 3649..3864, 4169..4198
1001..1032, 1500..1602, 1672..1838, 2255..2392, 3203..3312, 3649..3854
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved