Takifugu_rubripes Locus RPS3
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes RPS3
Takifugu_rubripes
RPS3
scaffold_188
SNORD15
2777..2926
4787
CTAGTGTTTTGTTTGGAGGGTTTAGGTTTTGGAATCTGAGTTTACACATCCAGCTATTC
TGCGGAGATCAGAGGACATGAATAAAAGAGCAACTTAAGGAAACCTGATAGTCTGGCTGT
CTTTAGGGTCTGTTTACAGAATGATGTACAGTCATGGGTGAGACTGTGCTGCAAATGATA
TGAAGCATGTAAATATTGTTTACAGTTCTATACATGACTTTTTAGTACTTATGAAGTGAT
GTACCTGAAATTTTATCATTTATTAATTGATCAAAGGTTCAGGAAACAGTTTATGCCTTT
TTTATGCATGCCTTTTTTTAATCTAATTTTCTTTTTTTACTGTTTATTTTATCACCTCTA
TGTGTCTTCCATTAATTCTATAAAGCATTTTGTTTTGCCTTGTTGAAATGTGCTATACCA
ATGAAACATTTCAATCAATAAACCACTATTGGAGAAAGTAGTCTGTGCTGTTGGTGTGAA
GTCTGTCTTTGAACATTTTAAAAGTTCAGTGATGCTTACTTTAGGTGTTTATGTGCTTAA
TGTTATTAAAACTCATAAGTGAATTAAATTATTAACCTCCATACAAATAAAATGCAGTTA
TATGGTGTTACTACAGTTTGAATGCCCCACTGATGCTTTCAAAAGCAGCTGTTTGTGCCA
GCAATTGTCTGTCTGTTGGCCAAGCAGGGCATAAAGAGAAAGAAGAAACTTAACCGTTAT
TATTATTATTATTATTATTATTAACTGTTATTATTACTATTATTATTATTATCCTTGTTG
TTGTTACACAAATTGAATCTGTATGATATTATATCACATAAGTGATATTATGATCACAGT
CAACTTTCACTTACCATTTTAAAATACGGTTTATGTGCTCTTTTTTCTGTAACTATTACT
AATCAAGCCCTATATGTAAAAACTACTGCTCCCGCCATGCTTGTAATACGTAACAGGAAA
TGCAATTTTTGTATAAATTCATTTCCGTATCCGTTTAACGTCCTTTCCTGTCTACGGCCT
ATCGGAAGATGGCGGTGCAAATCTCCAAGAAGAGGAAGGTTAGCATTGCATAAACTCGTT
TTTTGTAAACAGACGTGCAGATTATAGTAAAATGGAGCCGGGTCGGTTAAGATAAAGTAT
CTTACGGTCCACTTTTATGTCATTGGCGCTTGTCCGTCTCCACCTCGTTGAGGATCATAC
CAGATGCTGTCGGCTATGTCTCATTTGGACAGTTAACATGGCTGAACCTAGCTAAGGGGC
CGGGATGTGACTGACTACTTACACGTGTGTTGCATAAGCAGTTTTCGCAAACCGTATATT
GTTGGCTATGAATTATTTTAGTAGTTGACATTTTAACGCATGTGCCGGGCTGCCAGCGGT
TGTCTCGTTGATGCATCAGCTCCGTAGAGAAATGAACATGGAGCTACAGCGAGTTGCGGC
TACACTCGGCTTTAAGGCATATTTAGGTGACGAGAGCACTTGTTTAGTTCGTTTCGCCAA
ATACATTGTGGGAGGAATCAGGGTTATTTAGGCTTCACTGAAACAAACCATTCATTGAGT
GAAGACTGCTGATGATCCCCACTGAAATCTATTCTCTGAGACTTCCCAGCAGAAATGTGC
TCAGGTTTGTAGGTCATGATCTGACCTGTGTAGCTCACCCCTACCTACTCCCTCAGTTTG
TCTCAGATGGCATCTTCAAGGCCGAGCTGAACGAGTTCCTGACTCGTGAGCTTGCTGAGG
ATGGATACTCTGGGGTGGAGGTACGTGTGACACCAACCAGGACTGAAATCATCATCCTGG
CTACAAGGTAATTATCATTTGCAGTTGATCCACAGCATTTTTTGTACATGTTATTATGGT
TATAGCTTTGTTTGCTGTCCATTTAACTGTCTCCAGGACCCAGAATGTGCTGGGAGAGAA
GGGCCGAAGGATCAGAGAGTTGACCGCTGTGGTCCAGAAGAGGTTTGGCTTCCCAGAGGG
CAGCGTCGAGGTAAATGATTTGGGACTGGGATTGTATTATATATTTTATTGTATATTTGA
CTAATGTTCCTTGTGTGGTTCCGCTCACGTCAGCTGTACGCTGAGAAGGTTGCGACTCGT
GGTCTGTGTGCCATTGCCCAGGCAGAGTCCTTGCGCTACAAGTTGCTGGGAGGCCTGGCT
GTGCGTAGGTAAGCATGGAACACTGCAGCTAATTTATGGTGAATAACTTCAGGTGCCCTG
GCTGTAGACTTTTCCCCTCATTTATGGAAGGTGCTGGGTTTTCTTAAGCTGCTGATTGAA
CTGCTGTTTTGGTTGCACTCATCACGACACACTTCGCACATTGTGTAACAACATGGGGTT
ATCATTACTTTAAAGGACAGAGCTAATTGACGGAGCTTTGTTTCCTATATAATTCTAGTT
TATTAGCAGCTTTTAGTTTTTAAGTGAGAGAATTGAGCTCTGTTTTTTATTTCCTCATCA
GACCATCAAATCTCCCCGCTAAACTGGAGTTGAAGCTTTAAATATTCCCTGCATGATTGT
AATTTACATAACTATTACTTGGAGTATTAGAAATAACCAGACCAAGAAAGGGGAAATCAT
GAATCACAAGTGACTAAAGTTTAAAATAAAAAGTCCCTTCTGTCCACTGTGTCACTCAGT
ATGGGCCTGTATTGTGGGAGTAGGTTGACAGAGTGTGGGGGGGGGGGAACAAAGGAAAAG
ACTGGTCCGGGTGTTCGAATTTGTTGTGTGTTGGCCCGAATGAACTTGGGACTTGTGTTC
AGTAAAGGTTCTTTTCCCTTCGGTGAAGATAAGATGACGAGTCGGAATAGGACAGATCCT
GCTTCTGTCGGTCACTGGTTCAGGTCCACGTTCTGTGGGTTTCTACCAGTTCTTCAGAGT
GGGTCGTCCTCTTCATTTGAAGACACTGAGGCATTTGTCTGAGAAGGGTTAAGATGGTAG
ATGGTGCCTGTTTGGTGGTTCCGTTTCAAAAGAAATCACGGGAGACAAAAAGTCCATTTT
AATTCTTGACACATTCCACCAAACATCAACATCAAATGGCTCTACACTTTTACAGGGCGT
GCTATGGTGTTCTGAGGTTCATCATGGAGAGCGGCGCCAAAGGCTGTGAGGTCGTGGTGT
CTGGTAAGCTGAGGGGTCAGAGAGCCAAGTCCATGAAGTTCGTCGACGGCCTGATGATCC
ACAGTGGAGACCCAGTCAACTATTACGTCGACACAGCGGTCCGCCACGTCCTGCTGAGGC
AGGGTGAGTTCACCAGCAGCAACCTTAACATCGGCAAAACACGCACATTCTGACCCAAGT
ATCTGGAATTAGATGTTTTTATTCAGCAAAACTTGACCAGCACGTCTGTGTACATTGATT
CTTTAATTGACTAAACTTTAATACACACATGCTCAGAAGATTTCAATGCAGCATTTACTA
TGATGTGAGTCCGTGGTTCCAAAAGGTATTTAAACAGTGGATAATGTGCCGCATTTTTCC
TGATATAGACGGTTTCACCAGCTTCAGTAATGTTTCCATACTATGGAAGTATGTTCAGGC
CATGAACCTGTACTCTGACCCAGCTAACTGCTGATGGGTCCTCCATAGGTGTGCTGGGCA
TCAAGGTTAAGATCATGCTGCCCTGGGACCCCACTGGTAAGATCGGACCCAAGAAGCCCC
TCCCTGACCATGTCAGCATCGTGGAGCCAAAGGAGGAGATCCTTCCCACCACACCAATTT
CTGAGCAGAAGGGCGCCAAGCCAGAGGTGCCAGTCATGCCCCAAGGAGCACCTGTACCCA
CTGCATAATCGGGTATGTCACCTGTGTTATGGTTATGTTAGGATGTAAACACAAACAATA
GAGGGTTTTGGTCGCGTCCCTTCAGTGATGATACGATGACGAGTCGGAACAAAGCCGTCT
TGTTCTGGGGGTTGCTGGTTCAGCTCTACGTTCTGTGGTTCTGTTCCAGTTCCTCAGTTC
AGGGTCTTTTTCTCTTGAAGACATAGAGGCATTTGTCTGAGAAGGGCTTGAAGTGTAAAG
ATCTCACCAGACAGCAATTCATTGCAGCAAAAACCTAGCTGGCTAGTTATTTTAGCCCCT
AATAACTGGGATTATGTAAAGGGTGCATTCACGTGACCAATTTCATCAATAATCATGCCA
AATGGTGACGACATACAAGAGACATGGTTCAGTTGTACTTTAAAATGTTTAAACGTTGTG
CTTTAAGTTACGTGATGGGTTCAGATCACATATTTGTTCAATACAAGTAAAAACTGCAAC
TTCTATCTCAAACAGCAGTTAAAACTTGAGACTGATTAAGATGATCACACAACAAACGGG
TTTTGAAAGAACTTATATTTAGCCTCATTTCCTTGTACATCCCAGTGTTGGAGGCACCCA
TGAAAGTCACTTCTATTTAATGTTTCCAGCACCAACGCTTGTTCAAATGTAGCAGAATTT
AACCTGCAGTCCTGTGGACTACAACATAAAACACACACTTCCTTCTAAAGTGCATCTTTT
CTGTTCACAGGTCTTGATTCATCACCAGCTGGCAACAAGACCTTCTGTTTTTTGTGTACA
AAAACAATAAAATCTGGAAAATGCCCAAGCGCTGTTAACTTTGTCTCCATCACCTTCAGT
AAATAAAAGGTAACGTGGTTGGATGCCAAGAGTGACGAGAATGACTCAAAGTAGCCATGA
AGTGGTGCTGGTGGGGCTGAGCTGGAGAGCAGCTTCATGTTTTAGCACCATCAGGTTTTT
GAGGGGACCGTACAACAGATCTGGCTGTCGTGGCAACCAAAGCATTAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1057, 1676..1806, 1896..1989, 2073..2167, 3055..3242, 3588..3787
1028..1057, 1676..1806, 1896..1989, 2073..2167, 3055..3242, 3588..3784
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved