Takifugu_rubripes Locus ENSTRUG00000003767
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes ENSTRUG00000003767
Takifugu_rubripes
ENSTRUG00000003767
scaffold_138
SNORA5
4099..4233
7290
GAAGGCTTCTTCAGTTCTGGCAGAACTGAAGAAGCCTACCGAAGCTGTACTTGGTGTTT
GTCGGCATGATTTGAACGGTATGTTAGTCTTTCATAATTATGGGCATTTCCTGCTGCAAA
TGTCACCATGTTTATTCATCAACAGCCATCGCGACAAACCGATCACATCAACCTGGATTG
AGCACTTTTGCCATTTATCTTGATTTAATTTTGTAAGGCTTTGTCAGCTTAGGCCTTGAT
CTTCAGAAGACCTTATCATCATCTTGGGTGTATGAACCTTTCTCTGACCACCCTGGAAAT
CCCAGCTACAAAATTTCAACCACCTTTTCAGGTCGTTTATAACGGCTGAGCTAATAAGCG
CCAAACTGACACAACCAGCGCGAACATCCATTATCGTTCAATGTTCTGAGGACGTTAAAT
CGGAGTTATAACGACTCTGGTGACGTCACCGTCCTGGGGTTTGGTAAAGTCCATATTAGG
TTTTTTTTTTTTAACTTTCCACAAACGTGATTGGCTCGTAGGTGTGACGCAATCATTATT
ATTTAAAGACCACTTCCCGTTTGATCCGCCCCCTCTACTCTAGCTGTTAGTGTGAGTGCG
TGTGCTCCTGAGCTCGCTCGGCACACATTCTAAAAAAACCTTAAAAAAATACCAAAAAAA
AAGTTAAAATATAAAAAACCAAAAATTCTTTATTTTTTTTATTTGTAACGAGTTGGCGAA
GCTGAAGTAGTCACTGGACCGGTGAGAAAGGACGGCTGAAACCAAGTGGAATCGGGTTCA
AAAGCGAGGCCAAGTACTGCTCATTTCGCCGTCACCGTTGCGTGTGAGACTGTTTTAATC
GCCAAATAAGTTCGCAGGTTTAGTTGTTTTTAAAGAACATTTTACACGGTCGCTGAAGCC
TGGCCAGATTGACGTGACGCTATTAGCCAAATCTTCACCTTCGCCAGAAAGTTATTCCAC
CGTCGACCGGAGTGGTTGGCTAGCATCCTCGAACGACCGAAATGAACCCCAGTGCTGCCA
GTTACCCCATGGCCTCCCTGTACGTCGGGGATCTCCACACAGATGTGACAGAGGCCATGC
TGTACGAGAAATTCAGCCCTGCCGGAGCCATCCTCTCTATCCGGGTCTGCAGGGACATGA
TCACCCGCCGATCTCTCGGATACGCCTATGTCAACTTCCAACAACCGGCCGACGGTAGGT
CAACCTGCCGTACAGCGATTAAATGCCAGAACGTGTGGTTGTCGGTGGAGAGGCTATACG
GTCCTTCTACACGTGACTGCGACCGACATGTTGGCTAAGGTCTCCTCGTTTGAACCTCCC
AGCAGGGGCGTATCGGAGAGGCGCCCCGTCCCGGCCACCCTGGCGCTAGCACTAGCCTGC
TAGCTAGCATGTACTTTCAGTATCCGTTGTGTTTTGGACAACGCCCTTTTCGTTGAAGAC
GCACCCTGACATTCCTTACAACTCTGCCATTTGGTGCTCCTTCCATGCGTTCAGTTGTTT
CCAACTTCAACAGTCCTAGAGATGCTCTGTCTGCCCATGTTTTCTAATCTGCGTGTCAGA
TAAGAACACAGGTCAGCCAGGGTGTGTTGCACCGATAGTGCTTTCCACTTATTAGGGAAA
GGAGAATAAAGTACTTTCTACTTTAACTATCACTAAGAGAAACAGATGTGCTATCTGTCA
ATTAAAAAGAGCCACATCTATGTGGAAGATGGTAATTTGAGGTTGGTCCGGTTTGATCTC
TTCACTTTCTTACTGGAAACCAGTCAACGGATGGGGTTAAGTGAAGACATCATTTAGATG
TTTAATAGAATGCTGTGTTGACGATTATCCACTTCCTTTCCAAGTAATATTTGCTATTAT
GGGCTGATGAACTGGGAGGAGTGCTTCAGTTTGACAGCAAACTTGTTGATTTCCCTTGAG
TCACTTTTTCTTTGAACGACTGCAGCTTTGTCAAATTCAGTGCTCTCTTTACTAGGTTGC
ACTGGCCAAAATAGCTGCAACAGTAAGTGTAATTCATGGGCCTCGCAATTCTTCGCAATG
GATTGAGAGGATAAACATGTATTACTGACAAACATATAACTGTACAATAATTATTTCAGT
GCTATATAGTTTTTGTAAGCAGCATATCCCTGAAGTAAACCTTTAAGTCCAGTTTTCTGG
CGTTACAACTAGTCGCCTTACACAGTTTGGTCAAATCATCTCAGCTCTGCTAGCAGTGTG
TGAAATTCCAGATGTCTTTGGTGACCTCTCCTGTGATCCTCCCTCAGCTGAGCGTGCTCT
AGACACCATGAACTTTGATGTGATCAAGGGAAGGCCCGTGCGAATCATGTGGTCGCAGCG
TGATCCATCACTGAGGAAGAGTGGCGTTGGGAACATCTTCATCAAAAATCTGGACAAGTC
CATTGACAACAAAGCTCTGTATGATACGTTCTCTGCTTTTGGAAACATCCTCTCATGCAA
GGTATTAAAGATAACACCGTAATAATGTGAATGATAATACTGTTTTAAAATGAAAAGGCT
TTTTATTGAGTCTTGTCTGATCGCCTACAAAAACCGAGCATGGCTTTGACTCGGGGGGTT
TCTTGCATGTCCTGCATTGTACCAGACATACAGCAGTTTTGATGCGTTATCTTAAAGGTA
AATATCGACGTTTAGCTGCTGCCGGTTGATTAAACCCCCTGCATTTGTAAGAGTAGATTT
CTCTGTGCGGTCAGACCCTCGTTTCTCCCTGTTGTGGATCCAGACTGGTGAGATCCAGAG
CTGAATAATCAGTTTGTCAGCCCTTTGCTTTTGTGCTTTGACTGTGGGTCTACTTTGCAT
ATGTGTGTTATGTAAATGCACCAGAGTTTTTGAAACTCTTAAAAGGATCAACACCCTTCA
GGTATCTGTGAATCGCCACAATCATTAAACATTCAGTGCACTGGTCCTGTTTCCTTAGTA
TCCCAAAACCAAAGAATCTAGTTTTACTGATATCTTTGCAGTAAACTCTATTTAAATAAG
GTTACTGGCAAAAAAGGGTTGAGCAGATGAACAGTGTGGTATTGCATGTGTGTGTGTTTA
AAGGCAGCATGTGTTTTCTCTCTCTGAAGGTGGTTTGTGATGAGAATGGCTCTAAAGGCT
ACGGCTTTGTGCATTTTGAGACTCAGGAAGCAGCCGAACGAGCCATTGAGAAAATGAATG
GCATGTTGCTCAATGACCGAAAAGTGTGAGTGTTTCAATCAGTTATCAAATGTCCTCCGA
ATGCCCCGTGGTGCTTCTGCAACTGTGTGTAACATTAACCTTTTATGGTAACAGTAGGCT
TGAAACGGTAAAAGTGCAATTTATTGCCACAGAATTATAAACGGAACGCCTCTTTTGAAA
CATTCTCCTCCGTGCAGGTTTGTCGGACGCTTCAAATCCCGCAAAGAGCGCGAGGCTGAG
CTCGGGGCCCGCGCCAGAGAATTTACAAACGTTTACATTAAAAACTTTGGGGACGACATG
GATGAGGAGAAGCTGAGGGATGTTTTTAATAAATATGGTAAGTTGGTGTCTACGTCTGCA
GGCTTATTCTGTAGCGAAATGCACCAGGCTCAGAGTGGAATCTTTGCTTAGGAAACGCCA
TGAGTATCCGGGTCATGACGGATGACAGCGGGAAGTCCAGGGGCTTTGGGTTTGTCAGCT
TTGAGAGACATGAGGATGCCCAGAAGGTACGGGTGGCCATTATTTTCCAAGATGGGGGTC
GTCACCCTAGACCTGCAATGCCCAAAATCGAGCCAGGTTTTCTTTCCTACCAGGTAACTG
GAATCTGAAGCCTGGTTGGACAGAAAACCCGGCCGGATTGCAGGAATTGCAGGACCGGGA
CGACAACCACCGCTCTAAAACCCGAACCGCTTTATTCTGTATCGGCTTATTTTTCTCGTT
TGCTCCAGGCTGTGGACGAGATGAACGGGAAGGAGATGAACGGGAAACCGATTTACGTTG
GCCGGGCGCAGAAGAAAGTGGAGCGACAGGCGGAGCTCAAGCGCAAGTTTGAGCAGATGA
AACAGGACCGCATGACTCGCTACCAGGTCAGATTCTAAAAAGGCTGTGGCAGCCACCGTC
TGGTGGGACACTTTACAGCTGCAGCTTTGTCAAATTCAATGCTACCTCCTCGGTAGGTTG
CATTGGCCAAAATGGCTGCAACAGCAAGCGTAGTTCATGGGCCCCGCCATTCTTCCTAAT
GAATACTGGGGATAAATATGTACTGCTGACAATAACGTCGATGTTAAACCGTTCGTGTTG
AACAGTGCGTGGAGATAATATTTTGTGTTTTCAGGGTGTCAACCTGTATGTGAAGAACCT
TGATGATGGAATCGACGATGAGCGTTTACGAAAGGAGTTTTCGCCTTTTGGCACCATAAC
CAGTGCCAAGGTAGGACTGCCCCCCCCCCCCCCCCCATTCTTTTATTTTAAACCGGTACT
AAAGTTGCTCCGGTGCTGGGGTTATTTTCACATTCGACTCCGTCACTTTCAGGTCATGCT
GGAAGGCGGCCGCAGCAAAGGTTTCGGCTTCGTCTGCTTCTCCTCCCCGGAGGAGGCCAC
CAAAGCCGTGACCGAAATGAACGGACGCATCGTAGCCACCAAGCCGTTGTACGTCGCCCT
GGCCCAGCGCAAAGAAGAGCGTCAAGCGCACCTAACCAACCAGTACATGCAGCGAATGGC
CAGCGTGCGCGCAGTGCCGAACCCAGTCATCAATCCCTACCAGCCGGCCCCGCCCTCTGG
CTACTTCATGACAGCCATACCACAGGCCCAGAACCGGGGCGCTTACTACCCGGCAGCAGG
GCAGATGGCTCAGCTTCGCCCGAGCCCACGCTGGCCTACCCAAGGTGTCCGGCCACAGCG
TGAGTGACACATATTTAACGTGCACAGCATGATAATGGAATCCAAGTTTGTGTCTGTAAA
CGGCTCTAATGCTGGCTTCAGATTTCCAAAACATGCAAAGTGCCATGCGCTCCTCGGGGC
CGCGCCCTCAGATGTTCGGTTCCATGCGGCCTTCCTCGCAGCTGCCTCGCATGACAGCCA
ACCAGCGTGTCGGTAGGTTTTCACCTCAACTTGGTCACCTGAGGTGATCCAACCACAAGC
GTATGTTGAAAAAGTAGTTTGCTAATCACTTGTCCGCTACTACCGCAGCCACCCAAGCCA
TGGGTCCCCGAACGGCCACCACCGCTACTTCCATAACAGCCAATTCTGTACGGGGGGTGT
CCCAGTACAAGTATGCCACAGGAGTACGCAACACCCAGCAACACGTCAACGCTCAGCCGC
AGGTCACCGTGCAGCAGGTACAGCCACAACCCTATGAGAATGAAAATGTGCATCCTGTCG
TCTGGATGACTGATTTCTCTGCTCCTGCTCCGCAGCCTGCTGTGGTTGTCCAAGGACAGG
AGCCACTGACCACCACCATGCTGGCTGCTGCTCCTCTGCACGAACAGAAGCAGATGCTGG
GTAAGGGCCCGCTATTTTCCCAGCATGCCTCTCGTCAAATGCACATCACCGAATTTGCTG
CTTTTCTGTTGTCGAAATGTTCATCTTGTTCTTTCCTTCCACGCACAGGCGAGCGTTTAT
TTCCCCTCATCCAGGCCATGCACCTGAGCCTTGCAGGAAAGATCACCGGCATGCTGCTTG
AGATCGACAACTCTGAGCTTCTCCACATGCTCGAGTCGCCGGAGTCGCTCCGCTCAAAGG
TGAGTTCTGCAGGTAGAAGGTGACATTTTGTTCTAAGAAGCTGCAAATGGCAGGTGTCAT
GCCTCTAAATCCATGCTAATCTGGCACAAATCCACGGCTTTACCTGGATACACCCGTGTT
TAGATGTACTACTCTGCAGTCCGTCCCATTTGACCTCAGAAACACAAGTTCCTACCGCTA
AGATCATGATTCGAGTTTTAATTAGGTTTCGATGGATCTTATTCCAGGTGGATGAGGCCG
TGGCCGTGCTGCAGGCCCACCAGGCTAAAGAGGCCGCCCAGAAGTCTGTGACTAATTCAG
CTGTTGTGCCAAGTGTCTGAATCCAAGGTAAAACAGGGTTTATTTTCTGGGAAGATGCTA
CCATCATTCGAAGATTAGAGGTTGTGTTTGTCAAGTCTAAAGATTATGTTTCATATTTGC
AGAGCTGGGGGAGCCAGCTGAGAAGAACAAGCTGAAAAAAGGGGGAATAATCCATAAAAA
AGAGAAATGTATATTAACAAAATTACTGGAAAGTTGTCTCTGGTCAGATCTATGAAGAAC
TGGAACTCCAGGCCTGCTTTGCAGAGTTTAAAAGAAAAAGCACCAAAAAAAGTGAAAAAG
AGAAAATCTAAAATGATGATTTTGAGGGGTTTTAGGAGAAATCTGATAGAATACATTTGA
AAGCTTTCCTTTCTGCTGTTTTATCCCTTTTAAATGTTTGAATGTTTTGGCTGCAGAAGC
CTGTACTTGTGACATTTTCCTTTTGCTTGCTTGAATAAAACCAATAAAATCAGTCATTGT
CTGTTTCTAGATGTGCAGACTGTTGCACAGCTGCCCCTTAAGCATCACACAAATGACGGG
AAAGGTATTTTTGTACATGTTTATTTGTACTTTGAGTCAGGACTTTTGGCTGTTGATCCC
TGATCTTCACATACTTATTCAACACTCGGCACACCAGCGCGTGACGGCATGAACCATTAA
CTCGGCCCACTGGTCTTGATGGTACATCAGGTTGTCTGTTGGTGGGACGATGAGTTTACT
GGCCAAGAGTCTTGGTCTCATCTGCCAGCCTCTTGATTAAGGCCTGCATCTGCTGCTGGA
AAGACTCCACCATGGGCTGGATCTGAGCCTGCATGTTGGTGGCCATGGGTTTGACCTGCT
CCTCCAGGGTGGTGGCAAAGGTCTTCAGCTGCTCCTGGATCTGAGTGGCCATGGGCTCCA
GCTGGCTTTGCAGGTCCCTGTGTGGTTAAACGTGAAAGCTCAGGCTGATGTTCTATTAAA
CACCACCGGTTTAATGATAAAGAAATGTCCTGGTTTACTCACTGAGCGCTGACTGAGCTC
ATGATCTGGGTCTTGAGGTTAGTGATGTATTCACCAATCTTCTCGACCTCGGATGGTTCC
TGTCCGAAGCTTCCTGCGAATTAAACGAGAACCAAAGGGAGGAAAAACTCTTAATAAAAA
CACTCGAAGAGTTCTGAGACAAGTGCTTCGGGTGGTACCGTACCCTGGGTCAGAGCGAGC
AGGGCGACTGCAACGATGACGGCGACTTTCATGGCTGCTGAGTGGAGACCTGCAGGAAAA
CAAGCGGCGCTTTGGTATCTGTCGTGTGTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1193, 2267..2460, 3089..3204, 3377..3516, 3591..3685, 3908..4045, 4294..4389, 4492..4858, 4941..5051, 5136..5296, 5375..5459, 5562..5698, 5927..6026, 6122..6290
1001..1193, 2267..2460, 3089..3204, 3377..3516, 3591..3685, 3908..4045, 4294..4389, 4492..4858, 4941..5051, 5136..5296, 5375..5459, 5562..5698, 5927..6016
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved