Takifugu_rubripes Locus DKC1
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes DKC1
Takifugu_rubripes
DKC1
scaffold_136
SNORD83
4101..4178
6516
CTCAAAGACTCGGACAGACTGCCATTCAAGTGTTCAATGCCGTGATTATCGGTTCGTGA
CACCATTCGCTGTAATAACAGACCACAAGCCATTGGTCACCTGTGCAGCAGCACCTTGAC
TCCGGCGTTTATTGTTCAAGACTCAGAGGAACAACTGTGAAGTCATACACCTGGAGTGGA
GATGGTCCTGGACGAGCACATAGATGGAGTCAACGGTGAAAGAGAAGACGCATAGAGGTA
CAACACCACCATAGTTGACAGCTCAATCGAAAAGCAGGACTGAAAGAACTTATCCATCAG
GGATGGCCAGAAAACAGAAGGCCTGCCCAAAGAGCTGAACTTGCTGTGGAATCAGGATTC
ATAGGGCAGACAAGTGCAACGCCATCTTCACCCAGCTCCATGTGGTTGGAAGAGTTATGA
AGGAACAGCTCGAGCAGAGAAACATGTTTGGTAAACATGGCACTCAGCAGTTGTCCTGGA
AGAGCGTATTGAGCCACAGCGCTAAATTGCCCGAACACTGAGTGGAAACAAGATGAGGCG
CAACAGGAGCCATCTGCACAGGCCAGACGAGACGGACGTGCAAGAGACAGAGACTGTAAA
TAGAATCGGCTTTTACGGTTTAGGCACGGGAGTCACTGTGTACAAAGACAAGATGCATAA
ACCTGTGCAAATTGATTTAAGGTGTGGGTTGTTTTTTTGTTTGTTTGTTTGTTTTTTCAA
GAACAGAATAAAAACAGTAGTCATTGTGTCATTGTTCTATAAATTTAATATGAATATAAA
AGATATGTGTGTAGTCCGATTAAATTATAAAGAGTAACAACTGATAATAACAATAAAACC
TGTAGTCCGATTACATTTTCTCAGTCGTTTAGAACAACCTGAGCCGTACGTGTTTGCACC
ACAAAGCGGCAGTATTACATATATGGGCATCAAACCGGATATGAAGAAGAAGACGAAGAA
GAAGAAAGAGGAAGAGGAGGAGTCTGGACACAAATCGCTCATTTCAACATGGCGGAATTA
GAAGGTGAGTGTGCTGCTCGCGCAGTTAAATCCGTGCAACCTTTAAATAGCTTTATATTT
AATTGCATGGGTGAGAGAAACCAGACCAATCACTGAGTTACTAAACACAATCAGAAAAAC
ACTGCAGATGCAATGTAAAAATTGAAAGGAGCTACACGATTTCCCCCTTCTTATGCTTTT
CCAGGACTCGGTGCTGTTTCACATAAAACGACGGGTTTTTTTTACCATCTAAGATTATTA
TACCTTGGTTTTAGTGATTTGATCTGATCACCGAACTTCCTGGCAGGTTTTAACGTCCAC
GAGACTAGATCGAGGTCCACGTGTGCGCCGTTTGATGTGACGTTCATACCTTTTACTGGA
AATTAAACGTCAACACAATTAAAAGCAAAGAGACACTGTCTTGAAAGAAAGTCTCATTGT
GTGATTTTGACTGCGGATATTGGTGTAATGGTAGATGGAGCGATCAGAGCGCGCTAATGG
ACTGTTAGCTAAATTAGCGCACAGCTCCAAACCACGTGCCGCGGCAGAGGACACGTGGTC
TGGCCTCAGTCTTGAGCAGAACTTAAAATTTACGTTGTCAAATGATTTCACCTTTTCTTA
TTCGCACGCTGCATTGGAAATCATGTTTTACTCTTGCATTTCACGTTCTTAATTTCTGTG
TAATTGTTTTTCAGCCTCGTCTGTAAAGAAGAAGAAATCAAAGAAATCTATTGGAGATGT
TGGGGTGCGTTTGGTGTCTGTCCATTTTCACAATAATTGATTTTTATTAAAGTCTGAGAA
TAAAACCCACTTTTTTTCATTAGGAAATCCAGCAGAGCGGAGACTTCTTCATCAAACCAG
AGTCCAAGGTTCCCTCGTTAGACACGTCCCACTGGCCCCTCTTGTTAAAGGTAATTAGAA
ACCCTTTAATGGCTTTACTGTGTGTGCTGCAAATGCAAACATGCTTCCCCCCAGAGCAGT
CTTCAGCATGTGAAATGATGAATCTGTTTATCCATTCTCCGAGCAGCTGTCTCTTTGGTC
TCTGCCTCGTCTCCCGTTCTGGGGGACGGGTCTCTGCTTTTGTGGCGCGGTTGTCCCAGT
GTTTTGCTGGACGATGACCCGAAACTTAAGCGAGATTTGACCTGAGCACTGCCAAGATGA
ACTTTGTGCTCTGATCAGAAGATGCTGAGACTGAATTTAGTTGTACCCAAAATATAGCGA
CATCACTTGGCTCAATCTCTTTAAGCTGCTAAATGTGCGTGTTTTAATATTTAGAAAAAA
ATCTTCTTTTTGTGTAGAATTTTGACAAATTAAATGTTCGGACGGCTCATTACACTCCTC
TACCGAATGGAAGCAACCCCCTGAAAAGAAACATCCACGATTATGTGAGGTGGGTCACAG
ATATGTTTCGACCTCGCACGCCATCCACATGATACAAGATGATGTAGAATCACCCAGTAT
TTGTGAATACAATTGTTTACAGGTCTGGCTTTATCAACCTGGACAAACCAGCCAACCCAT
CGTCTCACGAGGTCGTGGCATGGATCAGGAGGATTCTACGGGTAGAGAAGACGGGTCACA
GTGGGACCCTTGACCCTAAAGTCACTGGCTGTCTAATTGTCTGTGTGGATCGAGCAACAC
GGTTGGTCAAGTCCCAACAAAGTGCTGGTAATTATATGAAATCAGGACAGATGGTCCATT
TTTTTAATCTTTTTCTTTCTTTGCCTCGATGGCCAGTAAAAGCCAGCAGCCCCCCTCACT
ACTCTCTGTGTGTGTTACAGGTAAAGAGTATGTGGGAATTGTTCGGCTGCACAATGCAAT
AGAGAGTGAACACACTCTGGCTCGGGTACGTTACCGACTTAAGTGCCTGGGTTGATGAGT
CTGCCTATATTAGTTGCAAAAATATTCCTGGGGATTTTATTGGTGCATAACATCAGTGTA
CAAATGACACTGGGGGGAGGGTGCAGTAACACTAAATATCAATTAATTAATCTGTTTTAA
TGTCAAGTCAGTCTAGCAACATTTCACGAACGGATGATTTTTGCTACATTAGACGCAACA
CAGTTGTATGTAAAGGTGATTGTGTCACATGACCTGGCTAATTTTAGACAATCCTGGCAG
TGAATGTTGGTCCAATGTGATGTTTTTTATCTACTAATACCGTTTTATCCACAGGCCCTG
GAAATGCTGACTGGCGCTCTGTTCCAGCGGCCACCTCTCATTGCTGCTGTCAAGCGTCAG
CTGAGGGTCCGAACAATTTACGAGAGCAAACTGATCGAGTATGACCCAGAGAGACGATTC
GGTAAGGCGGTCATTTATCTGTTTGCTGTTTGGATGAGGCGACGTAGACTGTAACCGTGT
CATTGTGTTTTAGGGATATTCTGGGTGAGCTGCGAGGCAGGGACTTATATTCGGACTCTC
TGCGTCCACCTGGGCCTCCTGCTTGGGGTCGGGGGTCAGATGCAGGAATTGAGGAGAGTT
CGGTCTGGAGTCCTGGGAGAAAAGGTAGTTATTACTTCCTGTTTGTTTAAATGCGATTCA
AAGTGTTGAGTTCTGTCCTGCTGCTCAGTGCAGGTCTGATAATTAGGCTTTGAAACAGGA
AGCTGCAGCAGAGGCACAGCTTGCATCATCTGCACTCTGAGACCTCGGTGCTGCCGACAT
GACCGCCGCCATCGTACTCCGCGTCATGACCGCCGCTGACATGGCTGCTTGTGTGTGTGT
GTTGTTAGGACAACATGGTGACGATGCACGACGTCCTCGATGCTCAGTGGCAGTTTGACC
ACAACAAAGACGAATCATATCTGCGGAGGGTCATTTTTCCTCTGGAGAAGCTGCTGGTGT
CCTATAAACGGCTGGTGATGAAGGACAGTGCTGTAAGTTGCCTCATCTCCACGGCAACCC
CAGCAAACACGAGACGTTTGAGTGATTCCGTGTCCTTTCCAGGTGAACGCCATCTGCTAT
GGAGCCAAGATTATGCTGCCTGGTGTCCTCAGGTACGAAGATGGCATCGAGCTAAACCAG
GATATTGTTGTCATAACAACCAAAGGCGAGGCCATCTGCACAGGTGAGGGGAGGCGGATG
AGGCAGCCGTTTGGAAGGGAAGCCACGTGATGATGTGATTGATGTCAGTAGCCGTCTGTG
CTGTGATGACCTCTGATCTATCACCCTTTTCTGATGGCTTCCCTCGTGTTCGGTTATTAA
AAGTGGACAAGGACCCGATTACATGGGCATACAAATGGTCAGATTTTTATGGTCATGTAA
ACGAGTGAGGGATTGTTTATCATTTATTAATTATGCTCTTTCAGCTGTGGCTCTGATGAC
GACGGCCGTGATCTCCACGTGTGATCATGGTATCGTGGCCAAGATAAAGAGGGTGATCAT
GGAAAGAGACACGTATCCCAGAAAATGGGGCTTGGGACCCAAGGTAGGCACGATTTTTAT
ACCCCTTTGTTCTGTATTATAGTGTTTTTCACTGGGAATTAAACATCTTCCCCATATTCT
CCATTTCTCAGGATGTGTAGATTACTAAAGATTTGCTAAAAAAAATATCCCGAACAGTGG
AACATGTTGGACGTATGCTCTTAGTTGTTCATGTTGATATATTTGTTGCTCGTTTATCAA
GAGAACTCTGCTACATTGATGATTTTTATGTGAGAACACTAAAGATTTTTGTTTGCTCAG
GCAAGTCAAAAGAAAATGATGATTCAGAAAGGACTTCTGGACAAACACGGAAAACCAAAC
AGCAGCACGCCGTCCGACTGGAGGAATGACTACGTGGACTACAGGTGGGCGACGTGGCTC
GGGTGGATATTAGGTCAGCACGCAGACAGTTATCCCTCATTTAGCTGTGGTGCTGTTTGA
GGGAGTCAGTCTGCTACATCAACACTCAGCTGTCAGCTTTATTACTCTGCCGAGTGCCGA
GTTGCAGCTCAGCTGAGAACAGTGTCATAACTTGGATATCGATGTGGTGCTACTAACGTG
TGTGTGTGTGTGGCTAATTGACTGATGTTAAATATGATCGATTTTTTTTTCTTTTGCTAT
TTTAACAGCATCAAAGTGAATCAGGAGCAAAATGAAGCAACCGCAAAGGTAAACTGTCCT
GATTTGACTGTTTTGTTTGGATTTTTTAATCTTTGAGCTATTTAACTGAATGGGGAGAGA
TTTTGGGGATACTGTGACACTCAAATACAAGCAGCTGATCAAGATATCTGCTCTGCAGAG
AAAGAGGGAGACGAGCGACACCGACGGGGAATCTTCACTACCCAACACGCCATCTGTAGA
GGACTCGAAAAAGGAGAAAAAGAAGAAGAAAAAAGCCAAACATCAGGAGGCAGAATCTGA
GGGATTGGGACAAGAGGCGGAAGCAGAGGTGAGAAGTTCACCCCAAACTCTCCTTTTTGA
CTTAAGTCCTTGATTATTGTGGATTGAGTTTGAACTTTGTCAAATGTGCTGCAGGCTGTT
GAAAGTGTAAAAAAGAAGAAAAAGAAGAAACAGAAAGATGTTGAGACTCCAGAGTAGCCA
GAACCGGTAGATGGGAACGTCAATCACCGGAAAAATGGACTGCAGGAACACCGTCTTGTA
TTTTTTCTATATATATAAATGTTTTTTTCAAAACTGTAAATAGTCAACCTGAAGATGCCT
TTTTGGGAATAAACTTGTTTTCTGTATTTGTCTTGTCACATCTGTCCTTGGTTATTGGAT
TTGTTTAGTCTAGAAATGAGGAAATTGGCAGAATTTTATGTTTAATATGTGCAAAACGAG
TCATATGGAGCCTTTAGAGTTGTAAACTGTCTATAATTCTCAAGTGACGTCATGGTGTAT
TTGTGGTTTACACAAGTTCATAAAAGAAACTAAACTCAAAGGTGAGCTTGATGCAGCTCT
GATGGGAGCGATTAAATCCTCCCAGTGCCATTTTATTTTTTTTACTTAATCCCTCTCCAA
GGCTGCTGTAGAGAACATCTGCTTCCAGATTTAATTCCGAACCGACGAGCAGCCTGTCCA
TGAGTGGTCAGACACAGCTACACGTCAGGATGCATCTCCTGGAGTTGGTGATGACCTGGA
CTCGGTGATCGGTCAGCGTTTTTAGGTCTGAGATCAGCTGCAGAAGATGAGGGCTGGCCT
GGTAGACGATCCGGGTCGTGTGTCTCGGGTCCGGTGCGTAAAACGCATCCAGAACCTCCA
GAGTTTCTAGATGCTGCAGCTGTGCCAGCTGCAGGAAATCATCATCCGACACGTTACGGT
GCCTGAAACACAGCGAGATATTGATCTGTAGTGGTTGGATGTTGGATGCCACCGTTTATT
TGTTGGTAATTAATGTAGAAGTGGAATTGTGGGAGGATTTAATTTCATACAGTGGGTGAA
CTAATTAGTGAAATTCCACTTTGACACTCAACCTTGGTGGTTTAAACCGTCGTACAATAA
ATGCGAACAGGATCAACGTCAGAGCTGGTCGGGGGAATTTTATTTTTATGGCTACTGATT
AGATATAAAACACTGACTGGCAGTTTGTTGGTGTACT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 1694..1743, 1823..1909, 2297..2388, 2482..2666, 2780..2844, 3174..3300, 3373..3503, 3728..3871, 3942..4062, 4304..4422, 4680..4783, 4896..4931, 5048..5087, 5218..5367, 5454..5516
1008..1023, 1694..1743, 1823..1909, 2297..2388, 2482..2666, 2780..2844, 3174..3300, 3373..3503, 3728..3871, 3942..4062, 4304..4422, 4680..4783, 4896..4931, 5048..5087, 5218..5367, 5454..5513
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved