Takifugu_rubripes Locus ATAD2
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes ATAD2
Takifugu_rubripes
ATAD2
scaffold_133
SNORA5
6020..6153
11468
TCAATATGTTTGATTTAAAGCAAGTAGCACGCTAAGCTACTTAGCTTGTCAATATCATT
ACTGATACGTTCACGGACTAAGCGTCACATCACGATAATAGTACCTATAGTGACAAACAG
TCCTGCGAATTATGTGGCGTCAGTGTCCCATCAAATGGTTCTGGTTCCTATACTTGAGCT
GTCAAGTACCCAAGTGTTTAAAAACAATATCCATCCTTGTGAGGAAGGGGTTAAAGCAAC
AACAAATAACCTCATTTCATTTGAATTTATTGTACAGGTTTGTAATAAGTCACGACACGA
ATTCATAAAACAGACGTTGACAAATTTTTTAGACCCCTGTCCTGCAATGTACATGTGTCT
CATTGACCTTCCAGGGACATGCTGATATGAAGCAGGAGAACAGAAGCAGTCTAAATAACT
TCCAGAGGAGCCGGAGACGGAGAGCAGCAGCGGCGGTCTCCTTTTCAAACACGGAGGTGA
CGGCCAGCTCTCCTGTTAATGAAGCCAAAGCTGGAGGATGCTGCACCAGGTTAAACCTGA
CTTAATTCCTGAAAAAAAAAAATTCTGTCCTGCTAGATTTTTGTGCATGTCGTAGATGTT
CCCTTTCTTGCAGGTAAATTTAAGAAAAGTGTTTAGCCATTGTAACCTCCGTGCAACACT
TGTACAAGAAATGTACATGCAAACATATATCCATTATGTAGATAAAGAAAATCAGCATTG
CATATTTAACATTGAAGTTATACATTTGCTCCCTTTTTTTAGGAAGTCTTCCCAGCTGCA
GAGAGAGGAAAAAGCATCTAGCGGCAATCAGCAAGCAGGTAACATTTCCTGAAGTGTTGT
TTCTTTCCAGTTTTAGCTCGCATGTTTATAATATAGATCATTTTGAGAAACATTTATCTA
ATTTAGCAGATGTCCCAGACAAAGTGGAGGGGTCATCGACTCCCAAGAGGAGTCGCTTTG
ATTTAGAGAGCAGACATATGGAGGAGAAGGAATATCGCTCAGTGCGCCGCAGCTCCAGAA
TCACAAGATGCAAAGTGAACTCCCCGAAACAGTCGGTGCTCTACAACCGCCTAATCACTA
AGTAAGGTCACCCAGTCTCTCAAACTCGTTACCGTGGCAAAAATTTGTTGCAGTTCAAAA
AAAATCTGCACAGTTGTATCACATTGTTTTAAACATTTTTACAGGACCCATAATTACATT
TAGTCCTGAAAGATGTTTACCACTAAATGCAATGACAATTAGATGACTAAATTCTTCCTC
TGATTGTCAGCACGGCCGAAGCAGTTCTCCAGAAGATGGATGACATGCAGAAGATGAGGC
GCAGACTAAGCGACAGAGAGAGCCAAGAAGAAGTATTACCAAACAGGAATCTACATTACA
TCAGATTGACTTTTTTTCGCTATTGGCTATTTTGCTGTTTGATTACGCGTAACCTGTTTT
AAACCTTGGCCGGCATTCACACACTTTTCTCTGAGCAGCGTGGTGTATACACCAGAGGAA
GAATGAGAATGTTGCTGAGGTCCAACATGGGCAGCAAAGACGTTGTGGAGGAGAAACAAG
GTGAGGCGAGAACAGAACTCTAGCATGATTGTAAGAGAACATGAGGTACCAAATGAGATT
GGTTTCTCATAAATTTAGGAGGGAATAAAGATGGTCATGGTGAGGAAGAGGAAGATGGAG
AAGATGAGGAGGATGATGACGACGAAGATGATGATGATGATGATGACGACGAAGATGATG
ATGATGATGATGACGACGAAGATGATGATGATGGTGAAGATGAGGAAGAAGAGAACCAGA
GACGTTATGACTTCAGACAAAGAAAGAATGTAGTTCGTTACCAGGCTCCACAGGATGGTA
ATCAATCATTTTAAGTCTGCTCCATTTGTCAGTTTGTTGGTGTTCAAAAATCAAATTCAA
ACAATGCAAATGTTTCATTTTCCCAATATCTGTATGGGTTTGATGAATGACAGTAATGGA
GCCTGCGGTCTGCCTTTTTCTCTTAGAACCCAAAGAACCAAGAAAACGCAGCTTGTACTT
CAAGGATCACTCATCTCCAAACAGACATGGATACAGATTCAGCCCCTACAACAGGAAAGC
AAGCAGGTAAATCGACAGTGACTACATCACTTCATCTAAAGGGAATGTTTGCTATTTAGG
GATATTATCCCGCAACATCACTTAATGGCCTTTCTACTTTTAAAATAGAATGTATTGGAG
GCAGAAGAAGCTGCCCAAATTCTCAATTTTGCACTCTTTATCTTTCTGATTCTGTCATTT
GTATCAATGTGAGTAGTTCTGAGAGATAAGATCCTACCCGCTCTAGTATTTCACCGCAGT
CTGTTTAGACTGCGTTTGGTGGTGGTCACATTTGAATGAATTGTTTTACAGTTTTGAAGA
TCAAATTAAGATAATTGTTAAATTATTGTGTATGGTGATAACTTGTTTGGTTAAATTAGT
CATGCTGGTGTTTCGTATAAATATGCATGTATGCATCTTTTTCAAAACTTTTTATTTACT
GACATTTATTTTCTATTTTATTTTGGGATGTTCAATACTATGATTTTCCTTTAGACCAAT
TATGAGTACTCACTCTTCACTACTCGCCGATACCACTGTTTTCACCCTGGGGTGTTTGAA
CAAGTTACTTGTATTAAACCAACTCCTCTTCATACTACTTCTTGCAACTTTGATTTTGTA
GAGTTTACATTCTGCAGTGGGCTGGTCATGGGTCCTAACTTCACAGATTTCCCAAACCGG
TGATGTTTTCGCAACGGAGCCGCGATAAGTGGCCTTGGTGTCACACCACAGCACCGCCAT
CACTGTCAAAGAGTAGAACTCGAGATAAGGGTTTTTGTTGCTGAGAATATCAGCGGGTGG
CATCGACAGCCATTCAGAGTAGATACTTGGAAATAACAGCGGTATCGAACTGATACCCGG
TATTGGTACTTGGCTATCCCATCCCTAATTTTAATCCCAGAATAATAGACCTGATTGCCA
CAGTTCCTAATATCGTGCAGGTAACCTGGTTCTGTGCTTGTGTTGCAGAAGGAGACATGC
CATTCACAACAGTGACTCCACTTCTTCATCTTCAGATGATGAGCAGTTCCAAAGAAAGAG
AATCAGGAACAAGTCAGTCAACAGGTGAGAACTCCTGCGTGGGGACACCTGTACACCACT
GCAACAAAACGACATGATTATTAGAAAAAATCCTTACTGTTTCAGCAAACTAAAACCATC
TGAACAAATTGTTTTATAATACATTTTCCTTGCAGATTTTTACCTTTGAACCTTAAGAAA
GATGACATTCTGGGCATCCATAAAGACAGGATGAAGATCGGAGCCAGCCTTGCTGATGTG
GATCCTATGCACATTGATAGAACGGTGAGCTGCACAGATGTGTTGTCTCGTTTTAGATGT
CACTGTTTACCTAATAATGGCATTTACTGTGTAATAGTGTACATTTGTTTGGTTGCTGCT
TAAATGGAGACCAATTATTAATAGGACAATAATGTAAAAAAACAAGCACCTAAACGGAAT
GTTATTTGGCATTTAGGTGCGGTTTGAAAGCATCGGAGGTCTGCGCAAACACATTTTGTC
ACTGAAAGAGATGGTGGTCTTTCCTCTGCTCTACCCAGAAGTCTTTGACAAGTTCAAGAT
ACAGCCTCCGAGGTAAGCTCCACATCTTTGAGGTTCTTAAGTAATTCATGTCTTCTGATA
TGGTGATCAGTTTGAAACTATAGTGAGTGGTAAGCAGAAAACTTTAGGTACCCAATATGC
TGGAGACATGGATTTTTCTTCATATTGGATTCATGCTAATGATGTCAAAATGCTGGTGCA
CAGTAGAAAAGAGATCAAGATATAACTGAGATTAAATACAGCGAATCTAGTTAGACCTGG
TTTGTTCTCATGCGTCTCTATCCCTTTATCCGAGTTGCTCAGTTTATATTTGGGTTAAAT
TGGTTAAAAAAATAATTGAATCCCTTATGATCAAAACATTTTCTCTGTTTTCCTTTGTCT
ACAGGGGCTGCCTATTTTATGGTCCTCCAGGCACAGGAAAAACCCTTGTAGCCAGAGCTT
TGGCCAATGAGTGCACTCAAGGAGAGAGAAAAGTCTCTTTCTTCATGAGAAAAGGTGCTG
ATTGTCTGAGTAAATGGGTGGGAGAGTCGGAGAGACAGCTGCGCTTGCTTTTTGATCAGG
TAATCACATTTTCTATCTATCTGTAAAAATAAAGCAACTGTTTTTAGTTATTATCCATAG
CATAATAAAGCAGCAGATGCCAGACTATAGAATTGATATTTATTAAAAATCTATTGCACC
ATTCACAGGCATATCAGATGCGCCCGTCCATCATCTTCTTTGATGAAATTGATGGTTTAG
CTCCAGTCAGGTCCAGTCGTCAGGATCAGATACACAGGTAAGCAGGATAGACTCCAAACT
AGATTTCAAAATATTGGGTGTAAACACACTTTTCTGCCTCCAAAGTTCCATCGTGTCCAC
CCTCTTGGCACTAATGGACGGATTGGACTCCAGAGGGGAGGTGGTTGTCATAGGAGCTAC
GAACAGACTGGACTCCATTGATCCCGCCCTGAGACGACCAGGCCGATTTGACAGGGAGTT
CCTGTTTGGCCTGCCGGACAGATGGGTAAGAAAATATAGAAACCTTTTGTTTGGGGAAAA
AATGGACACTGACTGACTTTTTATTGATCATCTTTTGTATGGAAGGCGAGAAAGGACATT
CTAAAGATCCATACCAGACAGTGGACTCCGCCACCTTCTGACACCTTTTTGGAGAAGCTT
GTGGATAATTGTGTCGGTATGTTTGTGTTGAAAATGATACAGTAGCATCAAACACAGTCA
GACAGTTAGAACAGGAACATTCCGTGTCTCTTTGCTTCCCAGGATATTGTGGTGCAGACA
TCAAAGCTGTGTGCTCGGAGGCCGCTCTATGTGCACTGCGGCGGCGATATCCGCAAATCT
ACACTTCCGCACAGAAACTTGTGCTCGATGTTGACTCCATTGCGATCACAAACCAAGACT
TTGTGTGTGCGATGTCAAAGATAGTGCCTGCTTCCCAGAGGTATATCTAGAATAAGCATA
TGATCCATTTTACACATTAGTTATGCCCTGTGGTTTCTTCTGAATCTAAATATGTACGAT
GTTGACTGTCATTATTAGGGCAGTCGTGTCGCCAGCCAAGGCCCTGATTCCTGTCATCCG
TCCTCTGCTGTGCGCTGCCCTGCAGGACATCCTTCACATACTCGGGAACGTCTTCCCACA
TGCTGAACAGAGCTTTCAAAGGCAGAAACGACAAGGTTCCGTACTGCCCGTTGGCTCTAT
AGATGAAAGGGCTCCTAGACTAGAAAGTAACTGTGGGTGTATTTATTTTCAGATGGGACC
TGTGGCATTCTTGATGATCTAATATTGAGTGAAGAAGAGGACATTGGGGACGTGGGAAAA
ACCTCACTGTCTTCAGTCAAAAAAAATGCTGCTGATGAACTTCTCAACTTCAGCAGGTTG
GTCAGCTGTTATTTAATAAAGAAGTGTAATCCCATGCGGGGGGGGGTATTCTGCTAATTT
TGTTTTAGATTTTATTAATCAAATATATTTGGACGTTCACAATTTCAATTAGGCCCTAAA
TTTTTTCCAGGATTTGTCAAGAAACCGAATTCAGGCGTAACTCTCAGTAAAAGCCTAATC
AGAACATTCCTGCTTTAGCTGTGTCAGGTATTCAGTGAGTCTGTCATATTTCATCGTGTA
GGAGTGTTCTGAGCGAGCCGACCTCCTGCCGTCCCAGGCTGCTACTAGAGGGCAGGCCAG
GCTCGGGTCAAAGCTCCCACCTCGCTCCCGCTGTCCTACATGCTTTGGAGAAGTTCACTC
TGTACACACTGGACCTGGCTGTGCTGTTTGGATCCAGCGGAACTATTCCAGAAGAGAATT
GTGCTCAGGTAACAGACCTCTCTTGACTTGCATTGGAAGGAATCTCGTGACCAGATTAGA
ATAGAGGTGATCTGTACTCTGGCAGCCTTGTCAAATTCAGTGTGTTCTGAAAGTGGACTT
CACTGGCCAAAATGGCTGCCACAGTGACTGTAGTTCATGGGCCCTACCTCTGTGCATTGT
GGGAAGTAGGGATAAATACGTACTACAGACACATGCCCAGTTCTCAGTTTAAGAACAGAT
ATGTGTTGTCTAGTTATGCTTCCGCCTCCACTCCTAAACAAATGGAATCTAGAGTTTATC
ACCTAGTACTTCATTAGATTAGTTCCTCCACCCATTGTTTTTAATATGAAAGATTGGGTT
CGGCACCTTTAGCTGTAAGAAGCTACAGGTGTGGTTCCTGTCGAGCCTTGGCAAGCAGCA
TACAGCATTCCCAAGTACCTTATTGCTCAATGCTCCCTTGACAAATGCTAAATACGGAAA
CGGTAAACACTAAAAATAGCAACTCATGACTGTATGTCTTGTTGTCACGTGGTTATTATC
ATCACAGTCCAGTTTAGACATGAATGAAGACTTTGTGCATATGCATGTGTTGGTAATGAT
TAAATAACACATTTGACTCTGCTTAGTATATATGATATGAATAATTTAAAAAATGTAACA
ATTATTTACTGCAATCTAGCCGAATGGCTTTTTCTTACCAGGATCAGCTTGTGGTATGTA
ACTGGTTTGAAAGCAAACACCAGTGTCAGTTTCCAGCATGTATAATGAAACAATACAGAA
AAGAAAAAGCAGGAAGGTGAGCAATGAGCTCAACCACACATTAGCATCTCATGACTGTGG
GTCTTGTTGGCAGGTGGTTATTATCATCACAGTCCACTTTAGACATGAATGAAGGCTTTG
TCTCATTCTGCATGTGTTGGTCGTGAAAATAACCCCTTTAACTCTGCTTAGTCCTGTAAT
CTCTGGTGTATAAGGCATGCCTAAATATAAGCTGCACTAGTAATTACAGTATTTGATAAT
CAAATTTTTACATATATAAGCTGCATTCACCTATAAGCCACAGGTGTCTCACTCAGTACC
ACAGACAGCGCTGAAGCACATATGAAGGGGAACCCTTTTTCCATATATATTACATAACTA
ACTAACTATTACATAATTAACTGGCCCATCCTGTTTCTCAAAGCTCACCCACCAATTTTT
TTTTTTTTTTTACTTTTCGGCAGTCAGGTTATTTCATGCCATAAATCATACACCACGATG
GTCCACCAGCAAAATCTTCAATTTTTTATTTTGGTGGCCATTACTTTTGCTCTCAGTCGG
AGCTGCACGGTGGAAACCCCTCGCTCCTCTGCTCTCTGCGTGTTTACCCAGTCTTCAGGA
ACGTTTACAACGTCCTCGGAAAGCTTTTGTCGTCCTTTAGCTTTGACAGTTCTTTGCCAC
CTCCAAAGTCTCATCATGGATTCTGTCTGTCAGTCTGACGTATCAATATCTATCCTGTAG
GTGTTCGTTGAAGCAAAGCGGACCTCTCCCAGCATCCTATATGTTCCTCAAATTGGACAG
TGGTGGGAAACTGTGAGCCCTGCCTTAAGAGCCACCTTCCTCAGCCTGTTAAACTCCATC
CCTACCTTCTCTCCTATTTTTCTGCTGGCCACATGCAGCATGCAGTACAATCAGCTAAGC
ATGGAGGTACGGAACCCCAACATGAAAGTGTTGATGCTGTTGAGTCAACACAGATATTTA
TGATTTAATATATATATTTGACAGGTGAATGTAAAACTGCTCTTTAATGACCCCTTTCTT
TTCTTAGGTGCAAGACTTGTTCAGTCTTAAGTATGGGGAAGTTTTCCAAATTCAGCCCCC
CAGCAGAAGAGAAAGGCGCAACTTCTTTGAGGATCTGATCCTCAATCAGGCTTCCAGAGC
CCCCATCTCAAAAAAGAAAGCTGGTGAGAAAGAACATGTGTGGAAATACAAAGGCCTGAA
TTAGTGTTCTGTTATGTGCTCTTGAGATGTATTATTTCCACATCTTGGTAATGCAATTTG
TAATATTAATTAATGTTTCAGGAAACCTTGGATGTTTGTTGTCACACCGGTTCTTAATTT
TGTGTGTTTATCCTTCTATTTTCCACCATCTTCAGTCCTGAATGCACTGGAGGTGCTCTC
GGTTGCCGCCCCACCTCCCCCATGCCAACTGACAGAGGAAGAAGCCAAACGGTTGGAGGA
GCAGGAAGAAGATACTCTGAGAGAGCTTCGTCTCTTCCTGCGCGATGTCACCAATCGCCT
GTCCCAAGACAAACGCTTTAAGGCTTTTACAAAACCCGTTGATTTAGCAGAGGTACGTTT
CCCCCTAGTTAATGTGGATTTACTGATAACTCCTTGACAGAATGGTTTTTTTTGTCTGTT
AATGTCATAATTTGTGTTACATCGGTCTTTTTTCTGTTTTTAGGTACCAGATTATGCTGG
TGTCATCAAAAAGCCCATGGACCTGTCAACTGTTCTCTGCAAGATTGACCTCCATCAGTA
CAACACTGTCAAAGAGTTCCTCGAGGATGTGGATCTTATCTGGCAGAATGCCCTGAAGTA
TAACCCAGATCAGGACCCCTCAGGTATGTAGAGTGGGGAATTCAAACGTCGGAGATGATG
AGAGCTGCCCTTTTTTCACACATTTGTGTTCTGGGTCTAGATCGCCAGATCCGCCACAGG
GCGTGTGCGCTAAAAGATACGGCCCATGCTATCATCAGAGCTGAACTGGATGAGGATTTT
GAGAAGCTCTGTGAGGAGATCAAAGTATCATGCCAAAGAAGAGGTAAATGATGTGTGTTT
GTGTGGGGGGCATCGACATTCGCCATAGTTTTGAATTTCTGTTAACATGTACCGGTAATT
TTTCCATTGACCTTTAATATACAAATACATTTCTGAGACATGGCCTGTGGTGTCACTGAT
TTTACACCATCAATGCTGTTCCAGCACCATAAAAAAAGTAAAAATGTGGGACTGCACTCG
AAAATGAACACCAGTAATTTCAAACTGTGCTTCACCATCTCAGGCGGCTCCTCCCTGAAG
TTTGCTCCCACTTACTACCACGTTCTTCCCAAACCTGCTGCTGATGCCAAGGTCACCAAC
TCCACCCCAAAAACTCAGGCATCTAGAACACCAGCTCTGGTTACTCCCACAAAGCCGTCT
GTTTCTGCAGCGCTGAAAAGCACAGGTAAACGCTGCTGCAAGTCAGGAAATTATATTTTA
AAGATGAATCCAAGTGGAAAATATAAAAATGTTTTCTCTGCAGGAGAAAAGAAAAGGAGG
CGGAAGAGTCGCTGGTCGTCTGGAATCTATGTCAAGAAGAGACTTGCATCTTCCCATCGG
GACAGAGAAGATGCACACTTGGCAACTGATGAGGACGTGCAGAATGGGGATGACAAAGCG
GATGCTGATGGGGGAGAAGAAGAGCAGACGGTGATGGATCTGGAGTTGGCGTCAGCTGAT
GGAAGTCGCGTTGGGGAGGATGGTGAGGAGAGATGGGTGGAGAGCAGTAACGCTGCTGAA
GGTGAGGCTGGCGCATGCGAAAACTCCAACAGGCAGCACAAAAGAGACTATATGGATACA
GGTGATGCAGAAAAACAGACTGAAAGGGCAGAAAATGGGTATGGTGAAGCCATTTCAGTG
GAAAACCATGAGGAAAGTCACACTGGGATGGAGATAGAAACTTCCAGCCATGGCACATTT
GTTCAAAATGAGACAGAGAAGCTGAAAGAAACTGGGAACAAGATTGTAAATGTAGCAGAG
GAAGAACCAACACAGATGGCCACCCCAGGAACTGTCAGAGAGGACCTGAACACTGGTGAG
ATGGTGTCATCACGGGATTCAGATGATGCCGTGCACTGGAAAGCAGGTGAAACTGATGGA
GTATGTGTGTATTTCAGAGAGACTCCAGGGGTGCATGACACGTGCTAAAAAGAACGCTGC
GCTACAGCAGCGGACAGTCAACTTGGACAAAGCTCAGCAGATCTTGGAGCAGAAAACTCC
TCTCGTGGTCGACAGAGACAAACTGAAGGTGCGTTGGATGGCTGCTGCAGTGATTGTTGA
ATCTCCCAGTGTGAGTAACCGCTTACGTGACGCTTCTGCCCTCCATCACTTCCCCAGGAG
CTGCTGGAGAGAGTGGTAGAAAAGAGCGAAGGCTACGAGGTCTTCCAGCTGGAGAGACTC
TACACTCATCTATGCCAGAGCATCTACAGACACAGACGAGAGTACAACAAAACAGCACTT
GTAAAGGCCAGTAACATTGCATCATCTCTACTGAAAATGCTCTTAATGTGTTGTAGAATT
CTGCCTCTGATTCTGTGTCATTTGATTCCCCCCCCCCTGCCATTCAAACAGGAGTTGGAA
CAAGAGATTGAGGATTTCTGTTGACGTTCTCCTGGGAAAATGCAGAAAAACTGCAGTTCT
GTTGTCGCAGACCTACAGAACCTTTAATTTGTGCTTGAACTCAACTTTTGTATCCACTTG
TTATATTAAATTAAAGTAATTTCCTGTAAGTGTGATTTTTTTTTTTTTAATTCCATCATT
TCCAGTGTATAAGCTGCTAGTTTTGCCCCCAGACGTCGAACCCTGTGGTTTATACAGCGG
TGCAGCTTGTTTGTTTTTCTCGCTCTCGAGCTTCATGCCAATAAACCTACAGAACAGGTC
GCAGTGGGCCAAGCAAAGGTATGGTAAATTATTTAGATCCCTAATTTGGTGCTTCATATA
CTTAACCCACCCTCATCATGGAAAATAAAGGAAGAAATTCAGTCTTAAGTATGGGGAAGT
TTTCCAAATTCAGCCCCCCAGCAGCAGAGAAAGGCGCAACTTCTTTGAGGATCCGATCCT
CAATCAGGCTTCCAGAGCCCCCAACTCAAAAAAAGAAAGCTGAACAAAAAAGGGAACACG
TGTGTGTAGAAATAGAAAGACCTGAATTAATGTTAAGTAGAGAGGGGAAGCGATTCCAGC
TAGTTGTGGCAGAGGTCCCTACAACTTTAAACACTAATAAGACAAATCAAATCCACCAAA
CTAGCTATATACAAAGCTGCAAACCCAAACCACAAAAGAAGGAAAACACACACGTTTAGT
AGAACCTCTGTACCACAGATGTGCTAACCTTCCTCCCTAACACAAAACCAACAGGCCATA
ATCTAGCCAAACACAATCAAACCGTGGTTCACTATGTTAAAATGGAATACCTAAATAAGA
AAGACAGAGCAGCTACTATGTGACTAAATTAAAAAGGTACCACGAAGGGCAAACAAAACC
CAAGAGGCCAGGCGGGACAAAACAGCGTCCCCACACCAGGCAAACTTTAAAAAAGAAACA
AAGCCAACTGTTTAAATAAACAATACTAAATCACACCAAAATGACAACATGTTTTTCCTG
GGTAGTCTGCATGAATGAATTTACTGTATTTGATGGCAGCTACTCAGGAGGCCACACACA
CACCACCTTAATCCAGCACACCAGACTGGAGTGATCACGACCACCCTGGGACACCAGAGC
TTGACAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1080, 1270..1351, 1475..1541, 1638..1856, 2006..2105, 3048..3143, 3275..3383, 3556..3671, 4024..4198, 4328..4416, 4476..4644, 4725..4815, 4902..5079, 5178..5314, 5386..5519, 5756..5947, 7440..7625, 7747..7882, 8075..8271, 8383..8542, 8620..8742, 8983..9144, 9223..9441, 9598..9774, 9857..9987, 10077..10205, 10311..10468
1001..1080, 1270..1351, 1475..1541, 1638..1856, 2006..2105, 3048..3143, 3275..3383, 3556..3671, 4024..4198, 4328..4416, 4476..4644, 4725..4815, 4902..5079, 5178..5314, 5386..5519, 5756..5947, 7440..7625, 7747..7882, 8075..8271, 8383..8542, 8620..8742, 8983..9144, 9223..9441, 9598..9774, 9857..9987, 10077..10205, 10311..10340
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved