Takifugu_rubripes Locus RS7_FUGRU
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes RS7_FUGRU
Takifugu_rubripes
RS7_FUGRU
scaffold_120
SNORA73, SNORA73, SNORA73, SNORA73
1697..1915, 2279..2497, 2942..3160, 3897..4115
5257
CATTTGTTCAGCTAATAAAACCTCATACACCGAGATGGTCACGGCGTGTGCGTGCGGAA
CTGCTCCCACCTCACAGTCGGCTCAGCACAATGGCCAATGTTAAGAGTCGCCAATAAACG
CGGCGATCATACACCTACAGCATTATAGACTCTGTTTGTCAGATATATATACGGAACGCT
TGGGCAAAAACTGCAGTCACGCATTCGAAGAACTCATTAACCATAAAGATGTTTGACGAG
TCCTATATCCGGGATCGCGGAGGCCTCGCGAGAATCTTCTAACTTCCTGCGTGAACACCG
CGTTCTCGCGATGACATCGTCAGTATCGGTATTAGATTAATACAACTCTCGCGATGTTCT
GGCCTCTTCCTTGGCCGTCGTTGACAGAGGTTAGTTGTGCTTTTTATGACAAGACTGATT
TTCTATCCTAAACCGGCTTTTAATGGTGTTCAGTTGTTGCGTTTATTCCCCGAGCAGCAT
CTTAAGTCTCTGATGCCTTAGATTGAGCAGGTTTGTGTGACGGATGGCTGTCGGATGGCG
TAAAATGAGGCGTAGTAAAGAAGCGCTAGCGAGTGGTTTGTAACGTAGCGGCTAACAGGC
CGTGCATGTGTTCAGTGTCGCGGCTAAAGCAGAGCCCGGACAAGGTGGCACAGCAGTGAA
TACATGGAGGCTCCGTTTACGAAAAAACGTGAACAATTTTCTAGCGAATTCGAGTCATGG
AGAAGGTAGAATAGCTAAATTCCGTTAGCTAGCTGCTGCTGGCACGATCTATCCAAGTAC
TGCTTCTTGCTAAGTTAAAGCTTGTTTTCCGATGTAATAGATTCATATTTTCATCGTCGG
TGTTGGTACAATTTTCTTTTTTAGTGTTGTTGGTGGCTATATAGCCCCCTTATCACGGAA
CCCGCTATGAGTAGATTTAGGACGCTAATTGTACCTGCCTGTTTTGTGCAACCTTGTAAT
AACTGAAGAAAATAACCCTAAAATGCGAAAATTGTGATTGCAGAGACAAAGGCCATGTTC
AGTACAAGCGCCAAAATAGTGAAGCCTAATGGCGAAAAGCCAGACGAGTTTGAGTCTGGG
ATCTCCCAGGTAAGAGGTCCATCATTCACACCCTTCAACTATACTGTGATATTGTTGTTA
AGGCCTCGTAGTGTCTGATGTGGTTCATCTCTCCGAGTTTATCCATAAAGTCATGTGCTC
TTACGGTAAATGTCCATGTAGGTTCTCATTCATCTAGTAAGGTGGAGCAGAGTCAACTGG
ACCGGTAAAAGAAACTGGCAGATGTTTTGCGTCTCATCCATGTGTCCACATGTCCTGTGA
GGCCACTGGAGAGGTGAAATGTCTTCCAGTGTCTTTTATCCATCCAGTTGACTCCACCTC
AGCTTAACAGACCCCACAGTAGTTATTTTTGTTTTTGAACATGCGTCCCCTTCCTTTGAA
ACTGTGTGTTATTTAAAGTGCGTACCAAATCTTTAGTGCTACTGAAGCTTTCTACACGGT
GCAGTTTTGTATCCGTGTTTTGGAGATGTCTCAACTGTTTCTTGTGGTGCTTATAGGCTC
TGCTTGAGTTGGAGATGAACTCTGACCTGAAGGCGCAGTTGAGAGAGCTGAACATCACTG
CAGCAAAGGTTTGAATGGACCATTTGTGCTACTACAAACTCCTCGTAAAGCTGTGAAAAG
ATGATTTGAAAGTCAGTCTGACGTGGACATCCAGCGAGCTGCTCTCCTGGCTCTGTCCTG
GTGGCGTATGGGAGCGTAGCTTTTCAGCAGAGACGTACATTCCCGTTCCACACCGTCAGA
GAGAAAGCTCTGTCCCCGGCCTCTGGCTGGCGTGGACGAGCGTCCTGTATATTCCTACAT
CTTCCCAGAGTCCTACTGGACCGTTACTGGGGAGCTAAACCATGCAGTGCACATTGATAT
TGGAGTTCCATAAAGGGGATTGCAATAGCTCAAGTTTTATTAAATAATATTGCCTTTAAT
TTTCAGACTTGCACCCCATTGTTTTGGACACTATTTAACTTTGGTACATGCTAAGCTGCC
CTTCTTTAATGGGCTTTTTTTTCCCTCAGGAAATTGAGGTTGGTGGCAGCAGAAAAGCCA
TCATCATCTTTGTTCCAGTACCTCAGCTTAAGTCCTTCCAGAAGATTCAAGTGCGCCTGG
TGAGGGAGCTGGAGAAGAAGTTCAGCGGAAAGCACGTAGTCTTTATTGCTCAGGTGAGGC
TGGAGGTTCACTTGGAAAACTTGTACTCAACTGTGGGTGGTGTTGAGATGTGTTTCACTC
CGACGTGGACATCCAGCGAGCTGCTCTCCTGGCTCTGTCCTGGTGGCGTATGGGAGCGTA
GCTTTTCAGCAGAGACGTACATTCCCGTTCCACACCGTCGGAGAGAAAGCTCTGTCCCCG
GCCTCTGGCTGGCGTGGACGAGCGTCCTGCATATTCCTACATCTTCCCAGAGTCCTACTG
GACCGTTACTGGGGAGCTAAACCATGCAGTGCACATTCAGCATCAGGCTAATGTGGTGCA
CATTAACCTGCTGAATCATATGAAGGCTTATTCAAATTCTTTATTAACCATGAAATTGGA
CAGTATAAATCAGGTCATGAGCAGAAATGCCAGACTGGACTGTCATTGTTGATGTCAAAT
ATTTCAGTTCCTAGTCTTGTTAAAATCCTTCATCTCTGATTGAAATGATATGGGATGTTT
TTTAGAGGAGGATTCTTCCTAAACCCACCAGGAAAAGCCGCTCAAAGAATAAGCAGAAGC
GCCCCAGGAGGTGAGTGGAGTTTGTCCTCAACTGTGATGTTTCTTGTTGAAAGTCTCTCA
CTAGTGTTTCATCACTCTTTACACATGGTGCTAAAATGTGCAGCAATGTTTTGCTCCCCC
CCACAACTATTTTTTTTATAGAATCTTGTTTGACTCTTCCCCCCAAAATAAATGCCTTTT
AACCGACGTGGACATCCAGCGAGCTGCTCTCCTGGCTCTGTCCTGGTGGCGTATGGGAGC
GTAGCTTTTCAGCAGAGACGTACATTCCCGTTCCACACCGTCGGAGAGAAAGCTCTGTCC
CCGGCCTCTGGCTGGCGTGGACGAGCGTCCTGTATATTCCTACATCTTCCCAGAGTCCTA
CTGGGCCGTTACTGGGGAGCTAAACCATGCAGTGCACATCAGTTTATGGCACAGAATGAA
ATGTTTTTCTTGTTTTGCTACATCAGCTGTGTAGAAATGGAGAATTTAACTTTGAATCAT
TTGAGCTGTGATAAGTGGTAAGCTAAAATGTCAGGAAACTTAGGGAAATAATTGTGACGT
CACAATTGATCTCATAATGTTTGCTTTTTTTTTAAATGTTGGAGCAACACAAAGCAAATA
ATCCTAAATTAAAGATGTGTTTAATCAATCTGACCTGCATTTCATGGATTCTTGATGCCT
AAGGGACTTGATTTTGGGGAGCAGAGTCATGTGTACGGCAGCATTTGTCCTCAGAACTCG
ACCGTGACCTGATGTCACCTGTCTCACAGGTGCCTACCGGTGATGGTCTGAGCCTGATAC
TGTTCAAGGCTGCAGTTCTACATTTAAAAACACTCAAAGTGGGGATCGTAATTGCGATTA
AATGGATCAGCACCTTTGTGCTCCGGCCTCCTCTGGTTGGCTGTGGTGATGTGAGCTCAC
ATAAGTTTTAATGTTGTCTGTTTCCCCTCAGTCGTACACTAACTTCGGTCCACGACGCCA
TTTTGGAGGACCTGGTGTTCCCCAGTGAGATTGTGGGCAAGAGGATCCGAGTGAAGATGG
ACAGCAGCAGGCTCATCAAGGTGCACCTGGACAAGGCCCAGCAGAACAACGTGGAACACA
AAGTGAGTGGATCTGCTGGTCTACATACGCCATATGTGACAGCGCTGATTGTTTTTACCG
ACGTGGACATCCAGCGAGCTGCTCTCCTGGCTCTGTCCTGGTGGCGTATGGGAGCGTAGC
TTTTCAGCAGAGACGTACATTCCCGTTCCACACCGTCGGAGAGAAAGCTCTGTCCCCGGC
CTCTGGCTGGCGTGGACGAGCGTCCTGTATATTCCTACATCTTCCCAGAGTCCTACTGGA
CCGTTACTGGGGAGCTAAACCATGCAGTGCACAAACCAGTTTGGTGCTGGTGTAACAACA
TTACCTCCATCCATGTGTTTAATGGTGTTCTCATTTGCAGGTGGAAACGTTCTCTGGTGT
CTACAAGAAGCTCACAGGCAAAGACGTCGTGTTTGAATTCCCAGAATTCCAGCTGTAAAA
TCAGATGGCAAAATAAATTTGTTTACTGTCATTGTTTGTGTGTTGCTTCAGAGTGAGTTG
CTTAATGTCTGGTATCAGTATGTCGTGCATCAAAGACATGAAGCTGTAGTACATTGGATG
GAGCATCATATTGGTTCAACCCACCAACTACATAAGCTGATCATAGTTGAGCTGTTTAAC
ACTGCTGATGCTTGAGCGTTTTGTCGGCCTCTAAGTATCGAGTACAGTGTGAAGCGTGCT
GGCTGTCCAGTTTTGACCGTGAAGACTTCCTGTTTGGATTCACTACCGGGCTACGACGGA
TGACGCGTGTATAACTGCAGTAATGAACGACGGTCGCTAGATGGAGCTATTGTCAAATCC
TATTGCACCGATTTCTTCCAACTCATGTTCATTTATAATGAACTCAAACTTACCGCTTAC
GACAGTTTCTTTACTTGTGCGTCCTCAGAATTCAGAGTTTTCCACAGACTTGAACGCAGC
ATTTCCATATTTGAACGTGATTGGAGGGGAGTCGTGTGTGGGCGCGGCCATCCCCACGCG
CAGTTGGTCTCGTGCGATCCTCCGCCTGTAAACTGTCTCGCTAATTAGCAGCGCGATGAC
GGTTAGTTTCTGATAACAAAGTGCCTAAAACTCCGGAAGAAATGGACTCTGTTAGTAACT
GGACGCCGCAACAGGTGGTGGACTGGATGAAAGGTGAGGTTAAAGAATATCTAAATCATC
TGTTTACAGGTGAGCGGCTAGCAGCCATGGACACTACTGCAGAAAGTGTAAGGATAGATG
GGTCCTGGAGTTTCTACACAGTACAGCTGTACTCCGGCTCCGGACACAACCAGTCCATTA
GGATTACACACACTCTTCGCTTGCTTCATGCTGTAAAGTAGTGCAATAATAGAGTGAATT
ATTTTAGTCTTACAACGTTAAAGAACATTTTTATCCCACAACATTATTCCGTGTTTTCAG
GAGTTAACACGTATTTAAGTACCGGTTTTGCGGCTTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1088, 1556..1627, 2069..2212, 2705..2769, 3691..3841, 4180..4257
1014..1088, 1556..1627, 2069..2212, 2705..2769, 3691..3841, 4180..4254
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved