Takifugu_rubripes Locus RPLP0
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes RPLP0
Takifugu_rubripes
RPLP0
scaffold_116
SNORA63, SNORA63
1424..1552, 1788..1918
3914
CTTTCTGAAGTAAGTGCAGGCTACTCGGACGCACGACTTCTCGGCCTCTGACAGATAAC
TAAAAACGTGGTTCCATACCTCTGACGGAAGCAACTCAGACGGATGCACCATATTTTTGA
TAGGCGGTGTGCGCAACCATTCACACGGCAAAGACAGACACTTCTGTAACTTTGCCGTTA
TCAGTGCCAGTGTCTTGTTGCGGGTTTGAAAGCAGAAAAAAGTAACGAAAACTGGCGCAT
GTGTTGTGTTGATTCACGTCTAGTTTTTTCCGGATTGCTTTTTGCAGCTGAACCATATAC
AACACACCCAAAATCTAAACATAACCGTACTAAAGTGGTCCGTTACCTGTCCCCGACTTT
TGTCGTAAACGGGCAACGGACGCACACTCTAGTATTTCCGGTTTACGACATTACTTGTTT
ACGTTCTTATTACTTAGCCATCTTAGCCACTTAGCATTTAGCGAATCAAGACCAAGAGAA
CCCAGAGACAAAGGAAATGAATAGAATTGACGCTTTTGTGTAAATTATGGGTTTATTATC
AGTTTCTTCTCGAACTATTGTGTTATTGGCGGTTGTGCAGCAACATAAAGATTGACAAAT
ATGAGTATCCAATAGGTGCAGCGCTTTCCGCCTCTGCCCATAACTGCACTGTCATTGGCT
ACTTGCCTGACATATATAGCCTCCTCGTGTCGGCGCTCTTCCTCTTTCTTTCACGCGACC
CTCGTGAGTTAGGTGAGTCTTTAATACGATTTTAGCCGGTGGTTATTTAGGATTACAAAC
CTAAAATTCCATAGCTATGTATCAAGCGTAATTGTTTATTAGGTTACGTTGTGTATTTTA
TTTAAAAACGTGATCTATTGCGCCATAAAACGAAAATGCTAAAAGCCTTGCGCGGCCTGC
TAACGCTAGCTTGTTCTGCCGTATTACGTTAGCTCCTAGCAGCGTTGTTTCGACCATGTT
GGAGTACTTACTGATACCGTAACTCGAATCTTTTTGTTGGAAATCAGGTACAACCTTGTC
TTTAAACCAGCTCTTAAGCGATCCTTGGAAGCACTGCAAAGATGCCCAGGGAAGACAGGG
CCACGTGGAAGTCCAACTACTTTCTGAAAATCATCGTAAGTTGCGTTTGTGCGAGGTGTA
TAAGTCAAATTAATATCTTAACTTTTGTGTTTCCTCCCACCTCTAGACTTAAGTATGTTG
CCCTTTTTCTTCTCAGAAACTTCTGGATGATTATCCAAAATGCTTCATTGTCGGTGCGGA
CAATGTCGGCTCCAAGCAGATGCAGACCATTCGCCTTTCCCTTCGGGACAAAGCTGTGGT
ACTGATGGGCAAAAACACCATGATGCGTAAAGCCATCCGTGGACATCTGGAGAACAATCC
TGCCCTGGAGAAGTGAGTGAGTGGTTTTTGTGGACGTTGTGGCACAGCAGGATAAGTTAC
AGTGCAGCTTGTGAAGTGCTGTGTTGTCGTTCCCCCTGCACAAACTAACTTGTTTCCAGC
TATCCCTGTTTGTCTCTTTCATTGGACAACCAGGGACGCAAGGTCTCGGACAATTGCCAC
ATCCATCAAGCAGTTAATGATTTCTGGATCTGAAAATTATTCTATGGTTTCACAGACTTC
TGCCCCACATTAAAGGAAATGTGGGCTTTGTCTTCACCAAGGAGGATCTTGCTGAGGTCA
GGGACTTGCTTTTGGCCAACAAGGTAACTATCAAATTCATGCTTGTTATACTGCAGACAG
GTTAGAGTTGGTGACTTATTTTTAATTCAATCACATCTAAGGATAACCATGCAGGATAAG
TTACAGTGCAGCCTGTGTAGTGCTGTGTTGTCGTTCCCCCTGCAAAAAATGACATGTTTC
CTCGCTATACCTGTCAAGTCAACTTCCCTAGATTGACAGGGACGTAAGGTTTCAGACAAG
TAGCCTTCAATGCTTTAAACCCACTTAAGGCTTCTATACCTAGGCTTTAGGGTTAATTTA
GATTGTGTTTAATCTGAGGTACCTGCAGCTGCCCGTGCTGGAGCGATAGCCCCTTGTGAT
GTGACCGTGCCCGGCCAGAACACTGGACTTGGTCCGGAAAAGACCTCCTTCTTCCAGGCT
CTGGGTATCACCACCAAGATTTCTAGGGGAACCATTGAAATCTTGGTAAGTTTTAAACAA
AATGATGGTGTCTCTTGATTAACCTGGGGTGTGGCTACTTGGCTCTATTGAAACTGAGTT
TGTTTTTTCTTTAGAGTGATGTTGGTCTGATCAAGCTCGGTGACAAGGTTGGTGCCAGCG
AGGCCACGCTCCTCAACATGCTGAACATCTCACCCTTCTCCTATGGACTCATCATTCAGC
AAGTCTACGACAATGGCAGCGTGTACAGCCCTGAGGTGCTTGACATCACAGAGGCTTCCC
TGCATGCCAGATTCCTGGAGGTGAGGGTTCTATGATACATGCCATGAATCAAGTTTACCT
TTTTGCACTGTGCGATGCTCATGATGTTAAACTTGTGTCCTAGGGTGTGAGGAATGTTGC
TAGTGTGTGTCTGGAGATTGGCTACCCTACTCTGGCTTCAGTGCCCCACACCGTCATCAA
TGGTTACAAGAATGTCCTTGCAGTTACTGTGGAGACTGGCTACTCCTTCCCACTGGCAGA
CAAAGTACGCTCAAACTGGATGACTACACTTTTGCAACTGATAGATGAAACCTTTAGTTC
TTCTTTAAAAAAAATTTCTAGTGCAAATTGGGAACTAAAGTACTGATTTGACTTTCTCAC
AGGTCAAGGCCTACCTTGCTGATCCATCTGCATTTGCCTCTGCTGCTCCGGCAGCAGCTG
CAGTCACTGCTGCAGCCCCAGCTGCTGCCAAGGAGGAGGTCAAGGAAGAATCTGAAGAGT
CAGATGATGACATGGGTTTCGGCCTGTTTGACTAAAGTACATCAAATACAACAATGAATC
GTTCACACCAGGATTCAATAAAAAAGTAAAACTCCACGTTGCCTTGATTTACTTTGTGCA
AAAAAATGTAAGCTGAATGCTAAACATAAACCTTGCCTCACAATTGGTTATTTTCATCTA
CACAACTGTATTTTCTCATTTTGGAACCAATCTCTAAAACTAGAGATGCTTGTGCAAGAA
AATCCCAGTAGATTGTTTTCTTGCATAATTTGACCAGCCTGTTGACAACCTTGCCATGTT
CAAAGTCTCTTGATCACATCTCCATGCAAAGATTTGCAGCCATGCGATTGGCTAATTTTC
AATAACAAGCACTTGAACAGTTCTTTATTAGGTGGCCCTGAGTGTCTTAGCTAGTAATAC
ATGGATACGTAGCATAGTAGTTCACTTTCTGATGAAAGTCAATTGGCTTTGATCGTTGAA
ACTTCACCCCTCCCTTGGCAGAGGTAAATGATAATTGGTGTGGAATTGTACGATTTATCG
AATGTAACTAAGGTTTAATGATATGAGAGATTGCACAATTAACTTTTTGTGGTTATTGAC
TTTTACATATTACTCATCCTGAAGTTATGTTCCAGAGGATCTCCTCACTGCACCCAGCTC
AGCCAGAACTACGGTTGGGTGTGCAATTAACTCTAAAAATTTTATTCTGAGATTTATTTT
GACTGATGTCAATGAAGCCATGGCAGAACTAACGGTGTAAAAATGATGTCCCAATTGACA
CTTCTGAAATTCATAACGCCTATACACGTTTCCTAAAGCGTATAAAAGTATAAATAAAAG
CGTATATATAAAAGTGTAAGCGCTTTAACGAGTTAAAGGGAAGCAAAAAATAATACTTTC
ATTTCTTTAAAAAAGAGAACGGAAGTCACATCTGGCTACCGGAAGCGGATACTTGTTCAG
ATGGTTGGTTAGCATTGGGCTCGTCCATTATGGCTGAGGTATGCTTTTGTTTTTCATGAT
TTTACGATCTATGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1114, 1216..1391, 1615..1702, 1998..2144, 2234..2419, 2503..2643, 2762..2914
1061..1114, 1216..1391, 1615..1702, 1998..2144, 2234..2419, 2503..2643, 2762..2911
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved