Takifugu_rubripes Locus RPS17
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes RPS17
Takifugu_rubripes
RPS17
scaffold_105
SNORA71
3254..3380
4561
TCAAACTTATGTCAGGCAAGTAAACTTTTGTTGTACCAAAAAAAAAAATTGCAATAAAT
CCTTTTGTGATGACTGTTTGCTGATCATATTGTGCTTTTCTTTCCACTGAGAAATTTAAG
AATTAAATAAGTTATATTACTCATAACCAATTTTAGCAGAAATCCCTACTCCATAGTAGG
GATTTCTATACTATTTCTATACATAGATTTATTGCTGCACTTCAGGTTTCCGTACGCCAG
AGTGCGCAGTAGCACTGTATAGTTTTTGTTCTAGAGTTCCGGCAGTGGCTTTAAACTTCC
GCCGGAAGTATGCTTGTCCTCTTCTACCAGGCCGATCCAACATGGTGGGTATATTTTTCA
TGTTGATTTCGTTTATCTAATGCAATCCGCATCATTAAACGTTTAATTGGTAACCACGCT
GCCGCTTACAGGCACCAGGCCATTTTAAACAGCTAACATTCGTAATATTAATAGTTGATG
ATACCTAAGGAGCGTTTTATTTATCGTTATCCTGGGAAGAATTGGAGCTAGCCGAGGAAG
CGGTGCTTAGTTTCTTGCGGACTGAAGGAACCACTTTTCTTATCTGCGATTTACTGGCAT
TATAGGATGAGACTGACAAAACGTCTCCACTGTGCCGTATATGTATCCAAAGCTGAACCT
GGTTTAGAATGACCCAGTCTCCCTAGCTGGCATTTATAACTACGCCGGTTAGCTTCTTTA
ACGCTGCTAGCAAGACACCGAGGGGAGCAATTTACTAAGCAGAAGGCTGCTACAGTTACT
CTACATATCTTGCCGCACTGTGGTCGACGGGGACGATATTGCTGAAACCTTTGCTTTTAA
AATATTGGAACTGTTTGATGTTGAATTGGTTATGTTTTTGGCTTGTATTATCCACAGTCT
TTTTTCAGCATCACTGTAGGTGTGCTTGTAGTGACACATGGCTAGAATGTAACTCCTTAG
TAATCATATTGTTCCTCCAATACTGAAGTGTTCTAATAACTTTCAACAGGGACGAGTCAG
GACCAAGACGGTGAAGAAGGCCGCTAGGGTCATCATTGAGAAATATTACACCCGGCTGGG
CAGCGACTTTCACACTAACAAGAGAGTGTGTGAGGAGATCGCCATCATCCCCAGCAAGAA
GCTTCGCAACAAGATCGCCGGGTGAGTTTGCTGCCCACATATCCTAAACTGAATCCTATC
CTGTATCGAAAGTGATCATGGAATCCTTGTAGCCAGATCATTGATAGTACAGGAAGAAAA
CATGAGAGCCTTTCCCGTGTTTGGGGGACTATTTGTGCCCATCAAACCCTGGCGCTTTCA
TACACCTGTCAGCATTATGTAATCATTCGAACTAATCTTCCATTCTTCTTGCATAATGAA
TATTAAAGTAAAGGACCGTTTTTTTCCTCCCATCGTGTCTGCTGCAGGTATGTGACACAT
TTGATGAAGAGGATCCAGAGGGGTCCAGTCAGAGGAATCTCCATCAAACTGCAGGAAGAG
GAGCGTGAGAGGAGGGACAATTACGTGCCAGAGGTCAGTTACTCTTCTGGGCAGCTTAAG
TTATTGGAACAAACGCAATTTCAACTGAGTACAGTCCTGATCTGGAATAATTTGAAAGTA
ACAGAATAATTCTTCCAATATAAATTTAATGTATTGGGCTGCCTAAAGCTAACAGGGAGT
TACTGCATTGGTACCATGTTGACATCCTGGTCCTGCAGCACGAATGTTGTCGTGCACTTT
TTGGCCTGTGAGCTCAACATGGGTAACACCAGTTCCTGCTGTTGGCTACAGTACTTGTGG
TTTTCTGCTGCTTTAATTTTTTGCTTGTTTTAAGGTATTTAGCCTTTCAAGTTGCACGGA
TGATTTAGTTAGACCTAAGGCATGAAGTTATTTGCTAGCTAATATCGGGTCTAACTTGCA
CTCTAACTTAAAAGGATGCAAAATGTATAATTATCCACCGTTCTTGCTGCGGTTTCACTC
CTGTATCGAAAGTGATCATGATGTTGTTGCCAGGTCAATGATATAGTACAGGAAAAATAA
TTTGTGAGCCATTCCTGCGTTTAAAAGATTGTCTGTTCTCTTGGATTCTGATGCTCTGAC
AAGAGAATGTCATTGAATGTTGGAGAAGACAGACTTGTGTAATTAAATGTTTGTGTTGAG
AGCACTTGGACATGTCCATGGATGTTGGCTATCATTGACAGTTTTTGCTTGTTCTGTGGG
AGGCAGCACAATCTTGTACCATGCCTCTTTTTCTAATGTTAAGGTACCCAAAACAGACTG
CAGTCAGTTTGTTTTAAACTGGAAACACATGATGGGAGAAAATGGTAATATTGTCAAAGT
ATTCCAGGATACGTGATGCTGCAAAAATAGTGCTTTTACATATAAATGTGATTGTATGTC
TCATATCTGTGTTATTTACATGTTCTGTAATATCTTCAGTTTTAAGATGTAATAAGATAC
ATTTAAGCTTTTCTTTCTTAAAATAGTTTACAGTTTAAAGTGGTTCAATGTGGTTGAAAC
AGTCTAAAGACAAGTGTGTTCTCTTTACTGCACCTGTGCAGGTCTCTGCTCTGGACCAGG
AACTCATCGAGGTTGATCCTGACACCAAGGAGATGCTGAAGCTGCTGGTAAGTTTAGGCT
CCATCGTGCAGGCTGTATATTGGAAAGTGCTATGGAGATCATGGATTTTCAATAAATAAA
ACCTACTAGCTAATTATTTACAAGATGGATGATTGGACACATTTGGATTCAGGTATTTCT
ACACTTTCACCTCATGGGTTCTTTAAACCTTTTAGAATTCTGACTTAATCAAAGAACTTC
CAAACCAAGATTACCTTTACTGCAGCTATTCAAAATGTATTTTATTTAAGGACATTTTAC
AAAAGAAATCAATGCACAAAAAACTCAGGAATTACACAATATAACTTTAAACAATTGAAG
GTACAGTGGCAGTGTTGAAGTGATGTCTGAGTTCTAATTAGTAGCTTAACCGATTGCTTG
TCATCAACCTTATTTCCTGTTTGGTTTTGAAGCTCTGAATCTGTCCTGCTGTGGATTAGA
AGCTCCTTTAGCTGTTATTAGCTTGTATATTTTATTAGACGTGGACTTAACAGGCACCTG
AGGTTAATGAATAACTTAAATGACTGTCCTCTGCACAAGACCCTTCCTTAGATGTGTCTT
CAATACATAAACATGTCTGTAGGAGAGTTCAGTAGTCGCAGGTTAATGTAGAAGATATTG
GTGCTCCACACCCATCCTGTATCGAAAGTGATCATGGCGTGCTTGTGGCCAGGTCATTGA
TAGTACAGGAAGAATAACGTGAGAGCCTTTCCCGTGTTTGTTGGAGCTTGCGTTCCTCTC
AGACCCTGATGCTCTCTCACATTCTTCCATTCTAGAACCTTCTTGTGTGGAGAGCTCAGA
CCTTTTTTTTTATGTTGCAGGACTTCGGCAGTCTGTCCAACCTGCAGGTCACTCAACCCA
CCGTCGGCATGAACTTCAGGACACCCAGAGGAGTCTAGACGTCTGTCACATTTTCTTCCA
AATAAAATCTTTTGGGACAAAACTCTGTGTAGAACTGTTTTGTTTATATTTCCAAGTCTT
AAATTATGGGTTTAATTATAACACTCCGCAAATTCAAAGTCCCAGGGTTAAATGGATTTA
TTGAGCCAGGTGATTTGATGTTTGGCTTGCACCAGTTGAAGTAACAGTTGGGGGGACATC
TGTTGACTTATTACTCAGTTTTGGTCGTTAATGGCAAAGGATTTACCAGCACAAGTCAGC
TGAAGTCTTGTGACACTATAAATTATCTAATTGTTTAGACAATAAGTGAAGGTAGTTACA
TTTTAACATTGTTTTACACTGAACATGACTTTTTAGCTTGTAGTGATTCAGAGTATTTCA
GTCACAGCTGAAAGAAGTAAATCATTTAGATTCCCACAAATCAGGCTCTTTAAAAGCCGT
CTTTGGGAATCAAACCAATGTTGTGGCTCATAAGCACTTAAGCAGGATGACGTTGCAGAA
GGCCCCTCGAGGACAGTCGCACATTTTTCCAATGCGAGAACCTTTCCTGATGGCACAATG
TTCTCCGAGGTCACACTGGAGGCATCACACAGGGGGCGCATGGTTACAAACAGGAAGTGT
GCAGGTACATAAGTGTGTTTATGAAAGAGGGACTCACAGAGGGAACCTGCCCATACTTCT
TCTCCCAAGGATTTATCCTCTTGGTCTGCAGCCTCTCCAGCACTTCATGCAGTGCACCGA
GCTAAACCCACACACACAAACGCACACTCACATAAGTACTTTGAAGGAAAATAAGACTGA
GCCTCATCTTTAATGCTGAGCTGAAATCATCAAAACTATAACACACGTTTTTAGCACCTT
AAGAACATGGAGTCGACCCATTTCTCTCTCAGTCAAATGCAGAGGAGCTGATAGGCTTTT
ATCTTCTGTCGTCTAGGTTACGGTAAGGTTTTTCTCTGCCCTTCCAACAAGGACAATCTC
TAAACTACAGTTACCGGTACTACAAAAACACCTGTTATATTACACTGGTTCCACATGAGT
TC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1160, 1427..1532, 2561..2626, 3440..3561
1006..1160, 1427..1532, 2561..2626, 3440..3514
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved