Takifugu_rubripes Locus RPS8
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes RPS8
Takifugu_rubripes
RPS8
scaffold_80
SNORD38
2233..2301
4380
TCCCTTTATAGGGTGTTTACACAGACACATATCAAGGAAGAATGTGATCTAACAGACCC
AAAATACAGAGATAGCAGGAACTAGGCCTACCTACCAGTGAAACGGATTTTCTTCAGACT
ACTTTGTGATTTTTTTCATGTTTATGTATAATTTCACATTTTTTTGTGATTAAGAATTAT
TTTTTCTGTCATATCTGAAAATTGTTACCTTTTGACATTGCAATTATTGGTTGAGAATGT
CATGATGAGTTTACTAAATTTACTAAACAAATCTGTGACTCAATAACCCTAAATGTGTTT
GCACATTTGATTAATGAACCCCAATAAGCTTTGTTGCAATATCAGACTACAATGTTTCTG
TCTAGTGCCAAAGATATAGTCAGTTTAATGAATAAAAGATGTCCTGTCAGAAAGGAATAA
TTCATTTTGGGTGAAATTTCAAGTCTCAGGAAGCCCTGAGATGCCAAGTTGACTTGAAAA
GACCTCATTTATACCATGTTTTAGAGAAAGTCTTTACTCTGTCAGATAGGTTGCATTCTT
TACTTTCATGTTCAGCTCAATAGTTAAAGTGAAGCTTCTGGTGGAAAACATGGTATGAAT
GACATCTTTTCAAGGCAGTTAGGCATCCTGGGGCTTCCAAAGACTTGGATTAGAATTAAA
AGATTGCTCTAACATATAGTAGGTGGAAAGGTTTGCTGGTGTTCAAGTTTCGGACTTGGA
CTAAACAACCAGTCTAAACCATGCCTGTGCAGAGTCTAATTTAATTATGTAGAATTCGCT
GGTGCTGGTGGAGAATAACTTCTGTCATTGCATCTTTAGGAGGCAAAAAGAGCAATAGAA
TGCAAAGCCTTAGAATCAACTAAAGTAAAACTGATTATACTGTAAGAATGAACGTGTTTG
AATAAGCATACATATTAAGATATTATTGAACTCCCCCGCTCTCGCTCTTCTTCTCGCGAG
AACACATGTCTTCAAACTTCCCCATGATGCTTTGCGGTTCCTCTTTCTAGCCGGCGCCTG
AGAATGGGTATGTCTTTTTCTGCGCGGGTCTGGGGAAGAATCCTTGTCCATCTGATGGTC
TATCTAAGAAATAATTCATCAACAGTTTGTCACAGCGAGGCAAAGTATATTTGAGATAGA
TGTAACTCTATATTTGCTTTTTTTTTTTCATAATTTTATTGCGTTTTAGCCAAATAACAA
GGCTGCCAGAATCTCACAAGATGGCTGCTCACATTGGCTAAGTAGTTAACTGCTAATGCA
ATGAGTGAATTGTTTAAACGCTTTTTGAAGGATCTTAGATTTTATAGTGTATCTATATGG
TCATTGGTGTATTTCCTCCGAGTTTGTTTTCTACGGTTTAATTAATCAGGTTTGCCATCA
AGTATGCTACTAAGGTTAGCTGCCATCGTGTCATGCTGCTTCAGTATAACAGAAACTCAA
TTTTGATACGCTAGTTTTGATGTTAATTTGTGCTTGGCTTTAAGTTTAAATTTCTTTACT
GAGGTTAAAAATGTTTGGTTGAAATTTAATTTAAAATGTGAACGTCCACTTTTTGAGAAA
AAGTGCATTTCAAATTAGCCTTTAGGAAATTGCTTGAGTAACGTGATGAGACTTAAAAGC
GGATTCCAAAATAATTTGCGGACAACTTATACCTTGGAGAACTGATTACTCAAGCAGAAA
GTAGTGACTATGTTGTCATCTTCTGAAAGGTCCAGCCTAATGTCTTGATTTCACTGTTGT
TTAAGGTATCTCAAGGGACAATTGGCATAAACGCCGAAAGACCGGTGGCAAACGTAAACC
CTATCACAAGAAAAGGAAGTATGAGCTTGGACGCCCACCTGCAAACACAAAGGTTGGTGA
GATCGTTTTGTATTAAAGTCAAGTTGCTGTGGGTGATGAACGTGTGACCTTAGGTTTGTC
TTTTTTTGGACCGTTTTGGTCCAAAACCTTGGGCTTACCTATGAAAGGACTTGTCATAGT
TACTCTGACACTGTACATTGTTGCTGTTTACAAAAGACAGAATTGACTAACAATGAAGTG
CCCCTAGTCTTAAATAATGCAACTTTTGTAGCTTGGACCCCGTCGTATCCACACGGTGAG
GGTACGTGGGGGAAACAAGAAGTACCGTGCTCTGAGGCTGGATGTTGGCAACTTTTCATG
GGGCTCTGAGTGTAAGTATATATTAAATGCTCTTAAATTTGTTGGAACCTCAAATGCATT
CGATCTTTATATCTTTCTGTGATGATAACTTTGTCCAGTTCTGCTACTGAATGAAAGTGG
TGATAGCAAAGACTCTGAGAAAGATCTTAGTGTGTAGTCTAATGTATTTAATACGCTTAA
ATGAACTGGTGTGGACTTTGGTTTTGCTGATGTTTTTTGGTGTACACAGGCTGCACAAGG
AAGACCAGGATCATTGATGTTGTCTACAATGCTTCCAACAATGAGCTGGTCAGAACCAAG
ACCCTGGTCAAGAACTGCATCATCCTTGTTGACAGCCTGCCTTTCAGGCAGTGGTACGAG
GCCCATTATGCCACTCCTCTTGGACGCAAGAAGGGCGCCAAGCTGGTTTGTACAGAAGAC
CACTTAATTTGATGTGATTGTTTTGCACCAAATATTGCTTGTTTTTGAAGCAGTGTCTAA
GGATACAACTGTCAAACTACTGTAACTGAATGAAATTGGTTTGCAACACAAAGGCATGTG
GTGAGGGCCAATGTGTGTATGACCTAACAAGTGTTTTTTCATAAAGTTGAGGCATGTCAT
TCTGAGACAATATCCAGTTCTGCTACTGAAAGTCTTGATGACAACGACTTAACACTGATT
CTGAAGGAGCACAAAGCTTGTTGGTCTTATTCTTTTTATTTGTTTTGTTTTACTGCAGAC
TCCCGAAGAAGAGGAGGTTCTCAACAAGAAGAGATCAAAGAAAACCCAGAAGAAGTATGA
CGAGCGTAAAAAGACAGCCAAAATCAGCACTCTTTTGGAGGAGCAATTTCAGCAGGGAAA
ACTGCTTGGTGAGTCAATGTAGCATTTGTAATGTTTAATTTCCTGACATAAGTACATATG
AAATTCAGAACATATCAAAATATGTTGCCATGGGAACTGTAGTTGTGCTACAGGCTGATT
AAAATGATACTACTGAATCTCATTTAAAACCTATTAACTTGTCTAATTTAAGGGATGGAA
TCTTTGAAATTAAAGCAACGGTCATTTTGAACCTTTGTTTCTATGGTGGTTGAAAGTTCT
CATGTGACTGAATTTTCCTACCCCTCTGCAGCCTGCATTGCCTCCAGACCTGGTCAATGT
GGCAGGGCAGATGGCTACATCCTGGAGGGCAAGGAGCTCGAGTTCTACCTGAGGAAGATT
AAGGCTAAAAAAGGCAAATAAATGTACAGCTGTTTGATGCATCAATAAAATCCAAATGCC
GCCATTTTTCATTGTTTTATTAAAGCTTACAATACAGTTTGCTTTTTTTATGCCCATTTT
CCACAAAACGAACCTGTAATAAGCACTGCTGCACCACCCTGGTGCCTCCACAGAAACATT
CCATGGGCCTGGTGGAGCAAAACCTGACCCATGTCGGTACATCCGAGTGAAACATGACCA
CGTGACCGTTGGCACCTGCTGGCTTTAAAAATGTCGGTGTTTTGTAGCCCTGCCCACGTG
ACCTAACCCGTTGTCCCACTGACCCCGGTTTAGCGCAGCTCGAAGATGGTACTTGATTGG
AACAAGTTTGGAACCGGTCAGCCGATAGAAAAACAGAATCAGCGTCGGCACTGGCTCCAA
ACCAGCCCTGGAACCTCTTGCAATGCACTAAGTGTGCGATGTGAAAGGGGTATCTACTGA
AAACGGAACCAATAGGGCGCCGTGGTATTAGTTTAACCTCTGTTCCTGACCCCAGTATTT
GACATAAGTGTAGGTTATAAATATTGGGGATGTGAACTTTTTCAAGGTGTCCGCAATCAA
AGCTAAAGGCGCTTTAGTAACATTCTTTGGTCAGTCGCTGTATCATATACCGGTCAATGA
TGGAAACAAGTGCAAGTAATTTCACTAGACAAATGAAACGAACGACGACAAAGTCAATTT
CGGATCATATTCATATTCAGCCAGTGTGATACAGTAATGTCAAAGCCGGTCTATGTACAC
ATCAACGCTCGCCTAACGTGCTCAAACAGTCTTAATCTTTATGTTATTTTATTATTGTAT
TTTTTAAATATTCTTTTTTTGGGGGGAGGGGGAAACTAGAGCAAAGGTCTTGCACATGCG
CAATCTGTTGACACGTAGTCTGGCTGTTTGCTGTGATTGGTTATAAACCCGGATATTAAC
GCTGTTGGGGACACAAGAAATCCAAAGTGACATAAGAGAAAAGTGGCAAGACTTTTTAAC
G
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1026, 1745..1851, 2071..2170, 2389..2564, 2878..3007, 3271..3380
1023..1026, 1745..1851, 2071..2170, 2389..2564, 2878..3007, 3271..3377
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved