Takifugu_rubripes Locus RPS12
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes RPS12
Takifugu_rubripes
RPS12
scaffold_72
SNORD100
2364..2445
4033
AGGAATTGATGAGAAAACTTGTAGGTGACAGCAAAGCTTTACCCCCCCAGATCTGCAAT
GGGAATGACTACTGTGGGGTAGGTCTGACATGAGAAAGAAAAAAAATTGTGTCACTGTGT
GAGTGTAAATTCTGAATGATTACGTACTTGCAATGTCAAACAAATTTAATTTTCAAATTA
AAATTTAATTTAATTTAATTTTTAATTTAATTTTTTTTAATTATTTTTTTTTGCTGCTCC
TGAATTTGGATGTAATAGACAATCCGAGAAGACACCACTTTATTGAGTGCCTCCTGGTTG
CACTTCCCTGAATACTTCTATGCTATACTCACTCCCCCCTCCTGGTATACCTCGCTGTAG
CATGCCACATTATGATAATAAAGTTAATTATAAAAAAAATTAAGCTAATTTTTTATAACA
ATTTTCATATTGTTGTCCAAGTAAAGCATGTGATTTATATGCTGCATTGTATTTTGAATT
TACAGTAGTGTTTTCTTTTTTTCAGGACTTTAAAGCATTTGAAAATGCCGTCGAGATGGA
GACTTTAAAGCAATTTCTCAAACTCCAGTGAGAATAAAGGCCGGCTATGGGACAGTAATG
TTAAGAAATGTGCTCAACATTGCTTTAAAGTTTTATTAAAAGAATGATATTCAAAGAATC
CCTTCTTCATTTTTTGTTAAAAAACAGAAAAATAACGTCAATAAATAAATAAATCAAAAA
TAAACAACACAACTTTAGAATTATTAGGAACACTTAACCTTATAGATTCTGTAATTCCGT
TCTAACGTGTTGGAGTTAAATAAAGTTTGGTTTTTTTTAAAAAAATTACGAATAATGGTA
AAAATAACTAAAGAGAAAAAACTAAAACAAGACACAATGGCCGATTCGTAGTAACGGTAC
TTTGATAAAGGCGAATGTTACAGGCAATAAGTTGGGCACCAAAGTAAGCTGGCGGATGGC
CTTTGTGGTATTAAAGCGGTGTCGCACCCTGATGACGTCCTCTTTAGTCGATGCCCGATC
GCAGGCTTTGGTACGTTTTCGAATCTGCGACACACTCCACAAGATTTATCAAGCATCTCA
ACTTATACAATCACTACAATAACATCTTTATGACCAGTAATGCATATTCTTTCATTGTTT
GTTGTTATTTCAGAACTTTTAAGTCAAACATCCATCTTGAAACAACAATGGCCGAGGAAG
GGTGAGTGACGCTATAATGCATTGGTGTTTTAAAAAAAAAAAAAAAAAGACTTGCAAAAA
TGCAGTAGATGTTATAATGTAAATAAGATGAATCTTAATTCCGAGTTGGTCTTCTTTGAA
GGGGCGACTTAAACTGTATTCTAAGTAGCATGGGCTACTAGCTAGCTCGCCTGGTTTCGG
GTACCTGCAGTCAGTCCATTAATATCGATCATTGAAAGGTTCGAGTTTATAAGGTTAGCT
TATAAACTCGTGCTGGGGTCTAAAACGACGGATTACTTGTGTATGCGAAGTAACATAAGG
ATTATACAGCATCAAACCACTGACAGTGGGTTGCGCATAAATATTTCCAAATGTTTATGG
TGGTTCAACGATTCTCTCAAAAGTACTTGGAATACATTGGTTCGATTGGAAAATGTGTCA
TTAAATGTAATTACAACTGTTGAATTTAGTGCAAGGCAGATGTCTGGCATTGTTAAGCTT
CTATCTGTAATTCATAGGTGTTTCAGCTTTTACTGTAGATTAATTGACAACAATTGTAAA
ACCTTTAAAAACGTGAGCTCCCGGCATTTGAATGATGACTTAAATCTTTTGTCGGATACC
CCTTCACTCTCCAATGAGTGAGATCTGTGTTCTGACCTGCTGGAAGCTCCGTTGTGTTAC
CCTAAATTGTTCGGCTTCTTTGGCTCCTGTCTGAACATCTAACACTTTGATCACAGCGTT
GCTGCTGGAGGTGTCATGGATGTCAACACTGCTCTCCCAGAAGTGCTGAAGACTGCCCTC
ATCCACGATGGCCTTGCCCGCGGTATCCGCGAAGCTGCCAAGGCTCTAGACAAGTATGTT
TTGACCTACTGCACGCTATATTCACGCGTTTATCGCTGATGATGTCTTGGCTCCCTCTAC
TGAGTTTCAATGTAGAAGTCTGCCATTGTTACCCAATTTTTGTCTGAGATATGTCTAGTT
TTTTTTTAACATGCAACGTTCATTGGATCAGTGTTTTAAAGTGTTTGGTTATATATTGCA
GGCGTCAGGCCCATCTGTGCGCCCTTGCTGCCAATTGTGACGAGCCCATGTACGTCAAGC
TGGTGGAGGCCCTCTGCGCTGAGCATCAGATCAACCTGATAAAGGTAAATAAACTAGACC
AGGCTGGTTTAGTGTCACCTGGTCTGCATCACTGATGATGATCTGGCTCCCTCTACTGAA
TATTGTGAGGAAAGTGCCACTGTTACCCAATGTTGTCTGAGATGCACATTTCCCCTACTC
AAATCTACGCTCTGAAGGTTTTTTTTTTTAATAGCTTAACGCGTATTTTATGTTATTACT
TGTCAAATGCACCTTTCATTTATGCTGAAAGTAAGGAAATAAGGCTTATACAAGCTGTTA
TCTTTAGGTCGATGACAACAAGAAGCTTGGCGAGTGGGTCGGGCTGTGCAAGATCGACCG
TGAGGGCAAACCCCGCAAGGTGGTGGGCTGCAGCTGCGTCGTAGTCAAGGTAAACATTCT
TCAACACACATGGGGCTAAAACTGATGTTAAAGGAATCTTCATGCCAGGCAAGTGCAGGT
GCTTGTTGTTGATGACATGCAGCTGTTTAACGAATGGCTATAGGACGGCCAGGGTACGAG
CCCCGCCACCTCTCTGTGGTGACTGGGGTCCCTAAGAACGGCTACATATGAAACAATGAC
ATTTGCTGCTAAAATTCATTTCCAGTTATTGTGAGAAAGATGCTAATTTTTGCCATTCCG
CCTTACAGGATTATGGCAAGGAGTCACAGGCCAAGGACGTGATTGAGGAGTACTTCAAGA
GCAAGAAATAAAATGTCAAAATATGCACACAAAAGTGGCTAATTTGTGTTTCTATCCCTC
TGGCCATCGGAGCTGGTAAAACATGGGACTAATGGGGAAAACCAGTTTCAGGACCATTAA
TATCTGGGTGCTGTATAAATGAAGCCACGAAGGTGATAAACACTCGATCTGTGTGGTTTT
TAAGGGAGAAGAAGACACGCACAGTTGGATAAGTTCTTTATCTACAGATTTTAAGGAGGG
AAAAAAAAAAGCATTCAAACACTTGGTGCACATCTCTGACCCCACCCCTGCCCCCAAATT
ACAAAAGTCCAGAATAGAGAACCCAAATTTTAAGTTAAACATCCACTACCCTTTAACTAT
ATTGTAAATAATTTACAGATGCTTGTACCACCAGGAAGAAAAACATACAAAACGGGTATT
AACACCAGTACATAAAACGCCGCCCAAGCTTATCCTGGGTGTGATCCAAACAGGCCTGCT
AGAAACCCGGGTGATGCACGGTTAAAAACGTTTGTCCCGGTAGGATCGTTTCCAGGCTGT
CCAGTCTGCTCCAGCTGCAGGGACGGGGAGGGGGGTCCACAGCGTCCATCTCCCAGTGTT
AGGCCCCTGCTGGACCTAGACTGGTTAGCGATCTAACCCCCCCGGCTGAGTCTCCTGTCT
CACCCCTCCTTTTAAGACCATTCAGTTTGTAATCCAGACATTTAAAAAAAAAAAAAAAAA
TTCAAACTTTTGCAGTGTATTAAATAAGAGGGCTGCCCAGTCGACCGTGTCCATGGTTGA
TGGTTCAAGTCCATATTGCCGTAATAGTTACAGGTACTCGAACTCCAGTGCTTGGTGTAG
TGCCAGCAGGTCAGAGTGACTGGATATCCTCCAGAAGGGCATGTTGTGCTGCGGAGTGGA
CACAAGCGTCAGTGAAAGCAGACGGTGGCCGCTGCATACCGCCACCTACAGGCATGCAAA
TGACACTACAGCAATATTTATGGCACCGCAAACGAAACCCATGCAGCTCTACTCTGGCTT
ACAGGAGGAGTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1029, 1153..1200, 1916..2032, 2221..2323, 2587..2688, 2948..3033
1187..1200, 1916..2032, 2221..2323, 2587..2688, 2948..3007
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved