Takifugu_rubripes Locus LARP1
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes LARP1
Takifugu_rubripes
LARP1
scaffold_71
SNORD111
14477..14559
20836
TGAGGCAGGCAGAACATTCCCCCACAAATTGAGACCTACACCTGGAGTATAGATAGTAT
TACAAGGTTACATAACATGGTAGGTTGCTTTCTGATAAAAGCCTTTTGGTCAAAGTACCT
TCTAGAACATTGTGAAATGTAACCAGCTGTTCCTTGGCCCATGAAAATCTTTTCTTTAGT
TATTTTGCTAACAAAGAGACAAGAGACAAACACCAGCTATCAGACAACCTCTAAAGTGGA
GGTATTTAGTATTTATTACCTCCGCCAAGCTTATGCAACAATTTTTGTTAGGTTTTTTTT
TTTTGAGTAAAATAAAGTGATCAATGTTTTTTTTAAATAAAATTTTCAGGAATTGCTGAT
AACGGGCCAAGGAACAGCTGATAAAAGCTTGGTGATGTTCCGAGAGACTTTGACCTCAAT
TTTCAAAGGGGTTTTGATTAGAAAGACTATGACCTTTTATCACTACTACATACACACACA
TACACACATGTATATGGGTGTGTATGTATATGTATATACACATGTATGTATATACATACT
AGTCACAATATGCGCGGAAATGGCCTGCTAGCTGGTAGTCTGCGCTCTCCGAGTGTTTTT
TTTTTTCTAGTTCCAGGGGACGAATAACTGAATGTAAGATGTTTTACACCACGACAGTAC
GTGAATGCATCATCTTGATTTGACACTAAAGCGCGCTCCCGGCTCTACGTGGCTACTCCC
CCCAACGGTGTACGTGCGCGCCCCCTTTATCGCGTGGTGAGGATCATCCATATTGCTAGT
GGTTGAGTTCAGGTTGTAATTTGAAGAGGCCTTCGGAAGCGTTTTTGTGGTTATATATAT
GTTTTAATCCACCGCCGGCTACTCTGCGTCTTAGACCTCACACTTTTTGGTCTAGTGGCG
ACAGAGGCGGAACAAATTTAGCATTTCCTCGTTACTCAAGTCGAATTCGGGCCGGGGGGA
GGACTGGTAATCCTGAGGGGTAAGAAAGACGGCGGTGGGAAATGGCCACTCAGGTGGAGA
CTCTCCTGCCCGGCAACCCGCTTGCCCAAGCGGAGGAGCACGGCAAAGTGATCCATGGTG
AGCCGGACGAAGAGGAAGGTGGCGGGGACGACGCGACCAAGCGTCAGACGGGTGTCGCCG
ACCAGGAGAGCGGCAGCGATAGCAGCAGCAGCGGCGGCGGCAGCCCTGGGCAGGGAGGGA
CCCTCGGTACGGAGAAGCAGAGTTCTCAACAGGCGACCGAGGAGAGTAAAGAGGACTGTG
ACAGTCCAGACAGCCCAAGCGAGGACGGCATTAAAGGCTGTAACAAAAAGGATTTGACCG
AGGCTCCTCCACCCAAGGTGAACCCCTGGACTAGGAAAATGAATGCGGTGACCGTGGTCA
ACGTGAATGGACAAGCACACCACGGTTTGTACCCTCCCTACGTGTAGATTTACTGCCTGT
CACTGTTATGTCGGTGCCCCCCCCCACTCCGTGTCTGCAATAACGACGCCACAAGGCAGC
TATTACAGGAATTAGAAAGCTTTTGTTGAATCCAAAAGCACAGAGGCTGGCGACAATCCA
CGTCTTGCGGTTGCCCCCTCGTTGCTCCCTCACGGCCAGGTTAAATTTGGAGTCACCCAC
CCCCCCCCTGCAAATTAAGTCTATTCTTGGTGTTCAGTGTGCTACAGTAGACCCAGGTGT
AACTGGTTCCACAAGGGATCACGCCCTTGCAGGAAATTAGAAATGCTCCAATATGCTTCA
TCTACCTTTTACGAAAACGGGGCTAAATCACTACTTTACTTGTGCAACATCGGGGAGCCG
GTCTTGAACCAGCTGGACCCCAAACTAAGCAACATTGGTGTTTCTGTGGATCTTCTTAAA
ATGATCTTTGTATCGATTAATAAGCGGTTTAGGCGCTTGTGTAGGTTGGCAGCACGTTTT
AGGACACGTTGAGTTGAGCCTTCGCGGATAAGTTGCGTTGCAGTGTCATCGCAGCAGACC
GGGGATTTAATGCGCTAGATTACGCATTTGGTTCTATACCTCATGAATTAAAACACCAGG
AGCGTAGATCTAAATGGACCTAGATAAGACGGCGCTACGACGATTGGCAAAGTTAAATTA
TTCCGTCTAGCCTGCTGTCAGTCACTTATCAGACGTTCACGTCACTGGCGCTCCCGCAAC
ATGTTTTTAACCCGAGCACCATCGCTGCTTTTGGAATCAACGTTCGCTTTAGTGTGGGCT
TTTGCCCTGCCAAGCATTGGTGACTTCTCCGCCCTCGTCTCTTAGTGCATCAATTAGAAG
AAAAGCCAGGGGCTTGGCCGGTTGTGTAGCTACTTAGCCAGCTAACAATAGTACCCAGTC
TCGTCTTTGGCCTAGCGCGTCGTCAAGCCCTTCCCACCCAGATGTTAGCTTAGCATCTAC
GTGGTCCCGCTCTGCCCCGTCGGCGCTTATCAAACATTTTCTGTTGAGAGACTTTCGTGT
ATTGGATGTCGCTTGAAATGCGGCGTTAAACACGAAACTTGTGCTCGTTTATTCTGCAAA
AGGGAGCAGGTTTGTTATGAGACGTCACGTGTTCACTCCACGTGTTCCCTCGTAGAAAGG
CATGAGGAGCGCTAGCTAGCAAGCTAGCTAGTTTCCCCTCTGCTTCAACGAATCCGTTCA
GTAAATCCCATTAAGTGTTGTCCCCAGTGCAATAAGCCTGAGTTTTCGCCTTGAATGATC
AATATGTCGTGTTGTATATTCCAGCCGGTGGCCGAAAGTTGTCCTTGAAAGTGTTAATGG
GCATAAATTCCACCAGGCGTTTTGACACCAGAGGTTTAACTCGTGTTTGAAATACGTTCC
CAAAACAAAATTAACGTGACTTCCAGCAATAATGCTGAAATCAAATCATGAATTTGCGTA
ATGACGACGCACACAAAGACATTTTTCTTTTGTGCGTGTCAAAGAAAAGTGGTGCATTGC
CCTTTTTAAGGATACTGTCGGGTCATTGTGTTTCTGATCCACGGGCTGTCATGGTTGTGT
ATTGCCCATGTGTTGGCTTTATTGGGGCACGTTGAAAGGGTAGAAACGGCACCCACAATG
ATGGGCAGTCTGCATGTACCTGATGGATTTGCTCCACAAACTGCCAGGCCAGCAGCTAAA
CCTGGCCGTGAGCCAGTGGCTGAGATAACCAGCAGCACTAGGGTGCTAATTTATCATGCA
GTTTGAGCCTAAATAGTGCAACATTATTTATGTCCAGACATGTGAACAGGCCCGAGTGTA
TGTGCATAAGTTAGGGCTTCTGCTTCCTTCTTTTTGGACTAAAAAATGACTCTACTAAGC
TTAGATGGCAGTATTTATAGTTTAGTATTTATGATAGATTTACAGCTGTCTAGTAAAAGT
CTTGTACACCATTCGCTCATGACTAAACTAAAATAAGGGTACAAATAGTTTTTTTTATCC
TTTAGTACTTTTTAAAAAAAAATCTTCTCAATTTGTTACAGTGGGATTAGTTGGCTGTAC
ATGGCTGAGTTTGTTTTATGATGAGAACCCAGAAGACATGGGCCCGTAACACATGCTGCA
TGTAAGAATCATACCTTAAAATGTGGGCCTGACCAAAGCACTTTAATTGTCTTAACGCCT
GTGTTGTATCCATCTGTCATCTTATCCAGGTGTTGACAATGAACACATTAGATTAGATTC
AACTTTATTGTTATTGCACATGTACAGGTACAGAGCAACAAAATGCAGTAGTGTCACATC
AGTAAGTGTCACTGAATTATGGTGTAAGATTACATGCACACACACACAGGCACATATTTA
TTTTATTTTGTTGCTGGTATGAAATATTAGATAACATTAAAAAACTGACCTTTGGTCTCT
CTTCAGTAAGGAGCGTCATACACTCTCTTATTCCGACCTTTGACCCTTTTCAGGGGCGAC
GAGAGATCAGTGTACTAGGATAGATGATGGTATGTTGCTTCAGTATTAATATGCTCATTA
TAGCAATATTACATCAATATTCTGGTGGTGACTAGAACTCCTCGGTTCCAACCAGTTACG
TGCGCATGGTTACCAGTGTTGCCAGACATTTAAATATGTGGAGCGGTGCCATGTCGTGTT
CTCGGTGTCGAAGGAATTGAAGAACTATGCATGGCTGAAGGTTCTGCCAGAAAAGGTTGT
AAATGAAGGTTTGGCAGCCTTCAGTAAAACTATGACATAAAGTCTGTTTATAATTTGATC
AAAATCATTGCATACCTTTCAACTCTATCTTCGCTTTGCTTTAACGTCATATTTATGGCC
TAATTATACTATTAAAAATGATTTACTAGCTCGTTAACTGTAAGAGCTACAATAGAAGTC
AGTCCACAAATTGTAATAATGTTGACTTAGCCCTGTTTATAATGTAGCTGGTGTCGGTGC
TTAAATCTGAATTTCCTTTTTTAAATTTCTGTATACAGTGATCCCTCGCTATATCGCGGT
TCATCTTTCGCGGCTTCGCTGGTTCGCGGATTTTTTTTGCGAGTCGTTCATTGCAGTTCT
CAAATATAATCGAAGGTGGCATATCCGTTTATAAAAATCTTCTTGCTCAGAAAAAGAAAG
AGCGCCAACAACTACCCATAACAATGTTCTTCTCTGGGAGAAAGACTCCTGCGCCTTCAG
TAGAAACAGACGCTCCAGCGGAGCGGAGTCAGGACGCAGAGGCTCAGCTGGGACTGAAAT
ACGCCAGTGACAATGTTTCCAACCTTGTATTACTAGATTAAAATTATTGTTTTAAACAAA
TTTTGGGCTTTAAAACAGGTTTTGATGTTTGGTTTCATTCTACTGTTCAGTATTGCATTG
TAAAATAATTTAAAAAAATAAAGTTGCTACTTCGCGGATTTCACTTTTCGCGTGTTACTT
TTGGAACGTAACTCCCGCGATAAACGAGGGATCACTGTATCTAAATTTGTGTGATGTTCT
AAGGCTGCGTGCTGTTCTTGCTGAATGCTCTCCAGTCCTTACATTTACAGGACGCTTAAA
AAACCCCAAATTACTGCGTTAACACACTATAACCGGGCAACTAAAGTGCATTTTAATGCG
GTAGTCCGGCTGCTATTAGAGTTGCTCTTATCCGACCAAGACACCCAGACGATGTGATTG
GAAACCAATTTTCCCCGGCACATATACGCACGCCTTCATCAGAGTTAAACTGGGCAGCAC
ATGAGCGCGTGCTCCACAACCCCCACGCTGGTGTATGACCCCGGAACAGAACCATTTCTT
AAACACGATGCCCACGAGTGTGCTTGAAAAGATGCATATTGCAGCGTAGTGTTTAGCAGG
ACATGTCCCCGTCACCTATTTGATTTTCTCTGCTGCCTGTAACCTGGGATGAGGCCAAAG
TTGAATTTTGAGCGCCGCTTGATTAAGCTGTCCGCGTAAACCTTTAGAATAAGTACGGGC
GTCTTTGTTTTTTGAGAGATTGTCCTGTTTGTTGTGGCCTGTTGACAGTCAGACCCAACA
CAATCCTCACCCGGCATCTCTCAGGTCTTCTCGCTGGGATTACGAGCTCCCGGGGCGCAG
CACAGGTCACAGACCTGGAAATGGTTAAGGGGAGCAGCTGTCGCTACTGCAGCTGCTCCC
ACAGCTGCTCCCACATTGGCTGCGTCGAGGCAGTATTGGACGAATAACGGCTGATATTGA
TATTGACGGCCAAGCGTCACGCCGTCAACAAATGTTTTAAGCAGCAGATAGATAATCGGA
GAAAATAACGGATACCAAAGTTGAGCAGCGGGCTATCCAGTGTTCACACGGGGCTCACTT
TTACACCAATAGTCCTGAGGCAAAACCAGTTATTTTTAGAGCAAATTGGTAAATAGACCA
AAATCCCCACAGGTTAAAATAAACCACTGATGGAGGATGTACACTAATGGTATTTTTGTC
CAAACTGGAAGTAAATATATTGGTGTTAAACTGCTGTAAGATGATTTGCGGTGTAGCTCG
TGCTTGGTGTCTATTGTAGCCAGACTCCACCTCGAGCTCTGTTTTATCTGTCGAATGGCT
GTGTCTGGGTTTGGTGATAGTAAAACATCCCTCCTGTTAAGGATTGGCACCGTGCACAGC
TCAGGGTGTGTGTGTTTTCATCGAGGTTGTTCCAGTTTTTGTTTGATTTGAGTGAAACTC
GTGGTTGCCTGTGTCAGGACCGCTCCTAACAGGACCGAAACCTGCCTCTTCAGGGGTTTT
TTGTTTTTCTTTAGAGTGGTTTTATGAGCTGATGAGTATTTGTTGCTCTCTGTGTTTGTA
TTGTGTAAGGATTCCCCCATTTTTAAAATTCCGGGCTCCAACCCTGCAGCACTCATTCAT
CCTTTAGCCCCAGCTTGGCCTCAGAATGATGTGACAAGCGTACCTGACATCCACTCTGGC
TCAGACCTGGGCCTGTTTTCCATCAGCATGTTTATCTAAGACTGCAGAGCCAACGTGGCA
TTAGGTTTATTTATAGGATTCAGAAGCGATACCCTCGGGGCTTTGGAGCAGGTATTGTCA
CTGGTGTTTGCCCAAGGGCTCCTGGGAATCAGTCCTGGGACTCCACCTGAGCTGTGAGGG
AGTTTACAGCTGTCGAGGCATTTAAGAAGAGAAGATTACATGGGAAGGCAGGATTTTAGG
ATTGTAATTTAAAAACAGGCAGACAATATTTTATAATCTGCAAGTGGATCACATGTAGCA
CTTAAATACGGTTGCCTTGATGAATATGTTTATGAATATATTTATGATTATTTAAATTAG
ATTGAAGATTGGAAGATTGGCTCTAGTGGAAAAGTGACGTTAGTCCGATAAGACTGGGAG
TGAGATACCTGCTGAGACAAGAGGGTGGGAAATTGTTGATGGGCTTTAACACAGCGGTGG
TACACGTCTGCACTAACATTTATTGTCCTGTCAGGATTATGGGATGCACATGTACGCTAA
TCCCATCATCATGTATGTTAAAGAATCCCCTAACGCATCATCCTAAAGAGTCCACCCTCC
CCATTAGCCTTAATAATAATCTACAGTCCATGTTTGTATCTTTTTATTTTAGCTCATGCG
CCACATGTATCTTATTATGGGATGCAAAGCACATGTCTGCATCAGGAGAAGACAATTTCT
TTATGTTTCCTGTATAGAAAAGCACTTGTTGCTGCCTGATGGTGGTTCTGCAGGTCACAA
TGTGGCGCTCTGTGACCTAGGGCTACGCCGCTGACATTTTGTCACCTGATAGCATCTGAT
ATGCTCTGAAGCGGTGACGTGGACGTGCCCTCCGTGGTGGAATCATAGTGCACAACTCAG
CTGATCGGCTCCACAAAATGACCCATTGATTGCCCATAGAGAGGTGGATTTTCTGAAACC
ACATCGAACTGGGTGCACTGGGTGAGTCCGGAGTCCTCGGAGATGCAAGTTCAAGTCCCG
GCACACATGAAATGTACAATGCAGTGATGTGTTTTTGTGGCTCTCGCAGGCTAAATTTAA
AAACCAGCTTTGAAGTAATTTTAGAAACAATGATTCTCCTCTTGACGGTTGCTCTGAAAT
GCCTCAACTGTCCTACTTTTTCCCGTTCGGTCCTAATAATGAGTGGAACCCAGTGTAACA
ATGGGCCATTCCTGCCTTGGGAAAGTAGTGACCACACAATAGTTGTTAAATGTTGTGTCA
TGCACGGTAAGCTGCTCTGTGATTTGCATTCCTCTAAAAAAAACGTTCACACTTGCGTTA
TCCAAACTAAGCAGATAAGACTGGATAATTACTCAAGGAATTTTTTATTTTAGATTCCCT
AGTTAGCAGGGCAGAGTTTCTCCATCGTGATCAGATAGTTTGGTGCCATTCAGTGTGTCC
TTTGTAGCCCCGTGTAGAAGACTCGACTCCAGTCTGCTGCAGCGGATGGTGCATGACCCA
TATATGCAGTGGATGTTCTACGCTGGTGTCTACTCGTTTATTCTGCTAATGTCCAGTTTT
GGTTGTTTTTCAGCAGTAGGGACCACTGAGTTTAATGGTTTAACCCAATCGAGCTGGAGA
AACTGTCACATGAACAGGTGACGTTTGTAATCCAGCTCCTGGATACGGTCTAGAAGTTCA
GATCAAATAATCCCCTGAATGGGAAGTGCTTGTGTAATGCCAGTATTAGTGTTTGTATTC
TTGCCTCTTGAATGATTGGTGGGCATGTTTAGCATGTGCCTCGTCAGCATTATTCTTGAC
CAGTGAATCGGTACCGCTCAGCCAATGGTCATCACCGATTGTGTGACGTCAGACCAAATA
ATATCAGGACTTAATACAAGGCCTCGTGTCAGAAGTTTCTAGAGCCTTCTGAGCTGCATT
AGAAAAATGCCGGGATGAAGGACCGTGACACAGTTAAGCAAGCAGAGTGAAACAAAGGTC
ACATTTGCAATGTCAGAAAGCCCAATTGGAATCGCTTTCAACCGCGTCTATCCAGACTTA
AGTAAACATTAAGTTTTGTGTTCGGGGGTCACGCGTGGTGACATGGTGAAGGACATGCTT
GACATTTCAGTGCTGCTTAACTGAACGTGGTCTTATTGTGACCTTTAGAGACTGGCTTCA
GGCTGGGGGAATGTGGCTGTTGGGGGTTTTTCTGTTGTTTCGTCTTTGATTACTGTGAGG
CATCATGTGAGTCAGCCTAAAGGGACCACGACATGTTTTAAAGATCACCAAACATCTTCT
CGTCTCATAAGTCTCTGCTCAAGGCTCCTCTGGTTGCTAACAGGACCCCCAGTCCCACTT
AAGTACAGGTTTAAAATATTTTTTTCGACATAAATCTGTCGCCAGATGGATTCCAACTGT
TGTTATAGTTCTGACTGTCTTTTTATATTATTCCACAGAATCTCCTGGCCCAACTAAGGT
GGTGAAAGCGGGAAACCCACCCAAGGCCAAACGTGGAGGAAAGGTAATGAACTGCTGCAT
TTTCTCAGAAGTGGAAAAAAAAATAGATTAAAAACACAAACAAAAGAGGTTGTTTTGGTT
AAAATGTAACTAGACAAATAACCGGTAAATCAAAACGATGGTAATGGACGAGCAAACCTA
GACAGCACACTGATTTAAAAAGAAGACTTATCTTCATAATAGCCTTTCAGTTAGGCATTG
GTTGATATGAGTGGGGCTGTTTCTGTCTGCCTCTAGCTTGGCGAGGTGCTCGCTGGGAAG
GGAAATAAAGCAGAATAATTATTTCTGCATATACTGGGAGTCCACCGTTTAACCCGGCTT
ATCATTATTCAGGTTGGTGATTTTGGGGACGCTAACAGCTGGCCAACCCCTGGGGAGATT
GCTACTAAAGACATGCAGGTAGGTGCTCCTGTCTGAAAAATGGTTGCGGGATGTGCTCTG
CATACAGCACTCCAGAGAAATGCTTTGGAACGGGTTGATTATTTGCAATCTTTTGTTTTG
GGCTGAATGTAAGTCTTTGTGGACATTTCTGCAACTCAGAAAATCTGATGATCCAAATCT
CCAGAGGTCTAAGCTCGCTACCCTGTGGTACTTCTTAGAGTAGCTTGTCTGTATTTTAAT
TAGACCTCCTAATATGTACATGTCATTTCATTAAATGCATTGAAGCACACAGCAGCCAAA
TATTTAACTCTACATTCCTGATTTATTAGTGACATTATTTGTATTATATCATGGATAATA
GACATTTTCACAGATGAAGAGTTGTGGGAAACTTCTCTGTAATAAAGGGAGAAAGCAGCT
GGTCTTCAACGCCTATTACATAAGCTCTGCTCTATCCTGACCCATCTCAGGTGTCCACAG
CACCCTCTCACCTTACACGAAACATACTGACCCAATCCCACCCACCCCCACCTCCAGCTA
CCTTACAGTAGCTGCAGCTTGCCCGCCTCTCAGCAACATTTTCTATTCCTGGGTTACACC
GTGTCACCGGGAGAGCAACCTTGCTAACCTCCACTATTTTAGGCTGCTTGGCATGGCAAA
TGTCCTCCGGCAACAAAATGTGGGTCACATCGTCCAGGGCAGTAATAACCTGCAGCTAAG
GTGTCAGAATTTAAAGGTGGGGACGAGTGTAATGTGGACTGCAGCCAAGGTCTGGAAAGG
GATCCCCGTCCTTAACCCAGCCCTGCTGCTATTTTGAGGCCAGCGGAGTTCAAGAGCCGT
CGCGTAACTTTTAAAGCCGCCGATCAACCACCGAAGACCTCGGATACTGAAATTGATGAG
CTGGAATTGATGAGCGTGCACATCCAGGGTGTAAAACGTGAATTTATCTGCCTCGCTGCT
TGTGTGAGTTGCTGCGGGTTGATTCTTCACAGAAATTCCCCAGGGCGCACTTAAGCGCCC
TGTTGGTGCGGAAGAGGATTTTAGAGATGACATGTGTAAAAATGAGCAGAAGTTGCACCC
ATGAGGCGTTTATTGTGTCATTTCTATGGGGTGGGAGAAGAATGACAGTGATGGGCAGCT
TTGACTGTTGCTGCAGCTTTAAGTGATGTTTCATTTTTAAGGGTGACTCATCGTCTGTCT
GATCTCTCTTTCCCTCCCTCATCATTTGCACATCTTTATTGAATGAACACACCCAATCTT
TCTAAACCAGTCTATCATTTGTGGCTGGGTTCACTCATTTCACACTTGCTTTCCATGGCT
GAAATAATTTGCTCACGCTCGTGCTCAGAATCCAGAACAAAATTGCTTGTCTGACGTGAC
TTTAGCTGCATTCATAAACCCAGAAGGGAGCACATGATTTTCTGGGAGATGGTTTTTGTC
CAGTTTGTTCTTCGTACCTTCAGGTAGTTCTGGTAGATCTACTACACAATCACAAAAAGT
GAAGACTTCAATAAACCTGACATAACGCATCATTGTGTAGATGTCCATCATGCAAAGTGT
GTGTGTTCTACATCCTGGTCCAGCTGTTGTCGTCTCTAAACTGCTTTTCCCTCCTTCTGT
TCAGATTGATTCAGCGACACAGACTCTGTCCTGCCCGCCGACTGTCAGGCAGGTCAGAGA
CTCATGGAAACCCACTGTAAGTTCCACATGTAACCTATAAAATCTGCAGCCTGCCTACCC
ACTTTTTGAACCTCTGAGAGATTAAAAACCCAATCTCCTGGATCTGGGATTCTTTTAACA
TCAAATATTTAAAGAATTCTTTTAAATTATATGCCTACACTGTGCTTTAGCACAGGTCAC
CTCCTGACCCCTACATGAGTGCTCAGTTAAATTTTATTCAAAACGTTGCTTCGGGGGGGG
GCATACATTTGCTCGATTAGGCTGCATGTGTCGGACAAAGCAGTACGTCGTGGCGTTTTG
TCTGTCTGTTCCGGTTACCAAGAGTTTATGACCTATGCCTCAGCCCACCAGCAGGGGCAC
TTAATAGTCAACTTCCGAGTCATTTTTGGTTCAGTTGAACAGTTGGTAATTTTATCATTT
CTTTCACATGCAGTTAGACAGAGTGAATAAATGAAACTTTTATCGCGTTCACATTTTTAA
CTGACGAGGATGCAGCGATAATAGTGCCAACAGCAGGTAACTGTCACATCTTCATGTGCT
GCGGGGCTTAATAGAGAGCTAAGTTTAGCAGGACCTGTCGGCCATTTAAAATTTACCCCA
ATTTATAACCCCAGTTTACACAAATCTGTATGTTTTACTGTTCTTGGAAGGTTCTAATGT
GATTATTTAGAGGTTATTTTAGATTGGTGCTGAGGTCAAAACCTGACAACGGCCAAATGG
CTGTCGTTCAAAGTAAAAATTGAAGTAATTGACACTTGAACTAGAAACTTGGCTCTCGTG
GGATCAATCTTATAACAGCGAGGTCCGTTTCAGCCCTCAGCCCCAGAGGTTAATCATAAT
GCAACGCTTTGTGAACGTACATTTTTAGATGCTGGTGAGTGCAAACATTTAGTGTATTTT
GGTTTTATTTTGTCTCTCCTCACATTGGTGAAGCTTGTTCTTGATTGCATGTTACACTTC
TAAACTTGATTAGGTTATTTTGCGGCGTGATACCTTGCAGGTTGATCTCATCAAGACTTA
ATGGATTGACCTGATGCCTTGCTGCACGTTTGCTGCATCCTGTCATATGACTTGCACACT
TTGCATAGCGAGTGTGCAGATATGCATGTTTTTGATAGCCAAGCTTGTGTAGTAGTGATG
AATGACTAACCTCTTTTTGATTTGAATGAAGGCAGATACCAGCCCTGCAAATAAAGATAG
CCAGCAAAGCAAATATGTTAGCACCATATGATCTGTCTTTCTCTTGCACTTCAACAACTT
CAGAGTTAACTAAAACTTTCCTCCATTGTTGTTTCACAACAAAGCACTGACTAACTCTTG
CTACAGTTTGCCTGAATCCAGTTATTCTCATTCTAAAAAGATCTGCCTCATGTGACTGTA
TAAGCTCTGTAGCCTAGCATGTTGTGTTGCAACACCACCAGGTGGTGGCGCCCTCTCCTC
ATCGAGATGGTAAGAATTGTTGATGGTGGGCCAGCGTCCTGCTTTATTTGGATTGTTGTA
TTTCATTTTTGACAGTTTACCCAACAGGCATAGATCAGTTATTCACCATAAGCATCTGCT
ATTCATTTGTTTTTCATCTTCATCCTTAATTATCACCCTAAATCCCCACCATATAATACA
TGTTGCACCTTTTGCACCCACCAATACCTTTTTAGGTTTAGCTGTAGCTTACTCTAGTTT
GTTGTTGGTGGTAAATTTGGGAAAGTCTCTGACATTTTGTCCCGTTGTCCAGTCCACCTC
ACTGGCTCGTTCATTGGTGTCCACATTTTGTCTTTTTGTCCCCTTCTAACAGAAAAATAT
ATATACACTAAAAGCAAACAGTGGTGTAACAAGTGATAGTTGGGAATTTTTGTCTTCATG
CTGTAAGTTTTTTCTTTTATTTTCAGTAGAATGATGCATTGGGTAATAAGACAGAGTTGT
GACTTGGGTGGGAGGTAGTCAGTGTAGTTCAAGAACAGTCACTCAAACAATGTTGGAAAT
TCTTCCATCATTCCACCTTTATGGATCTGCATAATGTGAATAAAGGTCAGTTTCACTAGA
GTAATTTGGTGTCCACCTCTGCGTGGCCATGCAGGCCTATCTTGTTGTAGGCCATCAAAG
CTCCTTCCCTGCAGTGCATCACAACAGATAAATAAAATGTCTGTGATATACAGAAGATGT
ACAGATTAAATGGAGTGTGACGGCCCAGCTTGTTTTTCTGGACTCATCAGAGATGTTACT
GCTTGAAACCACAAATGTCATTAAAGATGGTTGTGAAGTTGCATTTCTTCCCTTAACCAG
TTTGCATTGAAGAAAATTGCTAAGTCAGCAAAACTGTTGGTAGGAACCCATAAAATAAAT
AAACCTCATCCAACTTGTCTCCAGGGTCACAAGAAGACGTTGACAACGGCCAAGAAGGAG
TCAAAGGAGAAGAGGGAGATCATCGAGGAAAGCAAAGAGAACCTAAAGGCCAAGTCGGAT
GACTCTGGAGAGGAGAAGAATGGCGATGAGAATTCCCAAAAGAACGGGTCAAAGAAAAAA
GGTCAGCGTAGGTCACTGTGATGACGTGATTCTGTCGGTGCTCAAAGAGGCATCGGCAGT
AGGTCAACCTGCAGGTGTGCTGTAGAAGTGATGAGCTCAACATGTCTCTTCTCTGACTAA
ACATCAATGAAGAGAACTTTCACAACTCTGATCTCAGCAACAGGGTGTAAAATAGGAAGC
CTCCAAAATCAAATTGCTTTAAAATGTTTATATATGATGATACTGAACTGTTTGTGGACT
AGTCTGAAATCTTTTGGTGCTGCTTTACATCTTTGTATTACTGGTGATTGATGCTTATTT
TAAGCTCCACCGATGCCATCTGCTGGTCACTAAAGGTTCTGCATCCATTTACTTGGTATT
TTCAGTCTTAAAGACTTGTTCTCTTTATTTTTTAAATATGTTGTCATCTGTTATCAGGCA
ACAAGCAGAAATGGGTTCCCCTGATGATTGAAGTGAAGTCTGAGGGCCCGAGGGAACGCT
CAGCCTCCAGGAACAACAGCAGACCGAACGAACACGCGCGCCTCCCTCCAAATGCCAGGA
ATGACCTCAGAGGTCAGTCTGTGATGTCATAACGCTGTACTGTATTCACGCCTGTAGCAG
AACGATGTGCAGAGTGTGTGCACACTTATTGCCTTTTCTAAATATGTAATTCTTCTGTGG
TTGTGCTCATTGGAATGTTGTCGTTGTCCATATAGACTGGCACAGTCAAAAGTACGACAG
GGAATGGCGCGACGACCACGATGAAGTGTCCAGCGTGAAGAGCGAGGGGACCCCATTCCG
CGGTGGGTTCAGAGGTCGCGGGCGTGGCAGAGGAAGGGGGCGAGGACGTGGCAGGGGTGG
TGCAAGAGGTATGCTGAAAGGGACAATTAGGATTTCCTTTTACACATGAATCTACAGATC
TGTCAAGATCCTGGGGACCGTGCATGTGAATAATTCTCCTTTCTGTCTGAATACTGTGAC
TAAAGATAAATAGAATGCATTAATATAGTTTATTTACAGCGTGTTCTAGATATGTCGGTC
AGATCCCTTCTGTTGTTGCTGTAGAAGTGATGAGCTCTTCATGTCTCTTCTCTGACTAAA
TAATAATGAAGAGACCTTTCACAACTCTGATCTCAGCATCACATTAAAAGAAACCTGAAT
ACTCTTTAAAAAAAAAAAAAAAGAAAAAAAAAGCAGACTTTCAATTATCAATGATTCTAT
TTTTAATATACTATACTATAATTTGAAAATCAATCTTATCGCTTTCTTTTCATATTTATC
TGACTTTTCCATGCGGTGTGAGAGGCTTAACGTCTTCCCCGGTGTGTTTGTTTTTAACAC
AACACAAATTTTGAGGAACTTTATTCAAGGTGGGAGTAGTGTGAATTTTCAATCATGCAG
TTAATCTGCTAGAAAGCCATTAATCTGATAGGCTTTGCTGAATTAAATGCCCTTAACAAC
AATGAAATGTCTGGAGATTAAAAAAACAAAAAAGCACAATAGAAGTGATGATGGATCCTA
ATCATAACCTGTTTCCTGTCCCATCAAGGCCACTACGACTACGGCTATAACTACAAGTCC
TATGACGGGAAAGATTCCCCCTACGGTCAGAAGTTCAACAGCACGGTGACCTACTACTAC
GACAACATGAGCAGCAACGACCTTTACTCGGTCGATCATGACGTTCTGAAGGACTACATC
AAGAGGCAGATGTGAGTTTCGGCCCTCTTTCTTTAGCCGACAGCAAAAAAAGAGAGAGAG
ATGGTTGTTTCTGCAGGTCTATCTTTGGAATGAAGTTGAGCTTGTGTTTCTGTCTGTAGT
GAGTACTACTTCAGCCTGGACAACCTGGAACGGGACTTTTTTCTGCGGAGGAAGATGGAT
CAGGAGGGCTTTCTGCCCATTGGGCTCATCGCTAGTTTCCACAGAGTGCAGGCTCTCACC
ACAAACGTTGCCCTCATTGTGGAAGTAAGCACATTTTTCTTCCTGCTGTGGAGGGAAATT
TCAGATTCTGCAGCCGCTTTCAAATTTTTGAGCGTCATCCTGATCAACACTGGATTTGAG
AATCATTTTCTTTTGGCTAACAGGCTAATACAGTCAGAAAACATCTACATGGTCACTTGT
GTGATGGATACACAGTTTCATTGAATAAAACACATCCTCAGAGGGCAGAAAACATGGACA
GTTTTACTAATTAAACTGATATTTTTTTTTAGTGTTTAATTACATTTGTTAAACTAAAGT
TGACAAAATGATCAACTTGCAACTTTGGCAACACTAAGAAAAGTTACTGCTACTTCCTGT
ATTCAGACCTGAGATGTTTTTCTTTATCTTCTCTTCTGCCAGGCTTTGAAGGACAGTAAA
GAAGTCGAGGTGATTGATTTGAAGATCCGTCGGAAGGACGACCCATTGAAGTGGCCTCTT
CCAGGCCTGATGATGCCAAACCAGACTCACACTGATTTTTCTCAACTTATCAACTGTCCC
GAGTTTATACCCAGGCAGATGACTGAAGAGCCCAAAGGCAAAGTTTTATTCACTCTTTTT
TTGAGTTAAAATTTGACGTTGTCCCACAGATTAATGTTTCATGGACTTTCAATAACTTCT
TGCTTTAATCATCTTCAGGTTCTCCAGGGACCTCTAGCCCAGTAAAGCAGAAGACCAAGA
CTGACTCGGACATCTCCAACCTCAAGACGATGCCCAGGGGCCTCTCTGCCAGCCTACCGG
ACCTGGACTCTGAGTCCTGGATAGAGGTCAAAAAGAGGCCGAGACCCTCCCCTGCTAGAC
CCAGGGTCGGTGCAGAGAAGGTGAAATTAAACGCTGGCTCATTTCTGTGTAAAAATTCAG
TTTCCTGTTTGGAGTTTTAGGACCATGTGTCACAAATTGAATAATTTTATCTGAAGCTCA
TCCTGTCTTTCACCCGTGGCTCTATGGCTTCATTGAATCCAGGCTCCTTTGTTCCAGGAA
CAGAAGGAAAAAGATGACTTCATTCGTTCCCCTTTGCCCCAGACGGGTTCCTCGCCATCT
CCTGCTACCCCAGCAAACAAGGTAACCGCTGGTTACGCATTTCTTAATACATTTAGTAAT
ATTTATCCCTTTTTCAGGCTAGTTTGAAATATACATAATCAAGATGCCAGGGTCGTCTGA
TTAGGGAAGCTGGAGCTATAGAACGCTTTAGCTGACTGACTGTGTAAATCATTGATCAGG
ACGGAGCAGATCAGGATGAACCAGAGGAACTGGACTTCATGTTTGACGAAGAAATGGAGC
AGATGGACGGGCGGCGCAACACCTTCACCGACTGGTCGGACGAGGAAACGGACGGCGAGA
TCGACGACCAAGACGTCAACAAGATTCTGATCGTGACGCAGACGCCTCCCTACCTGAAGA
AGCACCCGGGAGGTGACCGGACAGGACACCACACATCACGCGCTAAGTTGACCAGCGAGC
TGGTCAAGGTGATCAACGACGGGCTCTTTTACTACGAGCAGGACCTGTGGGATGACAAGT
ACGAGCCTGAATACGCCACCATCAAGGTGAGTTCATTTAGAACTTAATAAAGTACCGTAT
TTTTTTTTAAAAACCACACTTTTTACCCGTAAACAGCACAAATCACAACGTGTGTCAGTT
TTTGGCTCAAACTGAGGTTCTCACGGGTTCCACATTACATCACTGGATTTTTGGAGGCGT
TTCTGCCCATAACAAATAACGTGTAGGGGGATTCTCCTTCAGCTGGAGCGGTTTCTGGAT
TTGAAAAACCAAACACTAAACAGAAAGTTTGTTTTGTTTCTGTCATTGTTGGCCATTGTA
GCATTGTGGAGGGCATTGTGGGAGGTTCGCATGGTCACCAGCACACGTCCAGCTGCAAGT
AGAAGTTTTTTAAATGAACAGCCTCATACAAGGCTGTGACCTGAGGTAGAAATGGACCAT
CGAGGGTGTGAAGACACTCGGTACAGTGACGAGGCAAGTGTGAGTCACGCGATGGAATAA
CGATCAGAACCTTTTTGGCTGTCCGATCCACTTGATGTAATGTTGATGTTGTTTAACTGA
GCCGCTGCTGCAGGAGGAGGAGCTTCGTTGTTATTGTCAGGGCTGATGTGTTGATCTAGA
CTCCCTGCCCGGGGTCTCGAGTCAGAGGTGTTAACATGAGGGTTAAAAAAGTGTTTATGG
CAACCATGTTTTGCTGCTACATCTCCATCTCCAGATTGGTGCAGCTCAGGTCTGTTGACA
ACTTGTGCTGACAGTCGTATTGCTGTGTTTTTAGCGTTGATGCCTGTATGTTCTTGTTGG
AGTTGTGGTTTATTTTAACCCCTGGGACTGTGGGTTTTTCACTCACGTGGATGTGTTGGC
GGACTGGTGATACTGTTCAAGGGTTAAGATCTAGTTTGTCTTCTTTTTCACAGCAAGAGG
TGGAGAACTTCAAGAAGGTCCACCTGATAAGCCGGGAACAGTTCGACTGTCTGACGCCTG
AGCCCCCCGTTGATCCCAACCAGGAAGTGCCTCCAGGCCCACCACAACCCCAGCAGAGTA
GGGCCATGAGAACGTCACCACAACACACAACAGCAGCACATCTTTGTTGCCGCGACACTA
AACTCTTATACGTCTTCAGTCCCCACAGACGCTTTGGCGAACAAACTCTTCGGTGCCCCC
GAGCCTTCATCTATAGCTCGTTCACTTCCTACTACTGTGCCTGACTCCCCCAACTACCGC
AGTGCCCGGACGCCACGCACACCTCGCACGCCTCACCGGAAGGACCAGACCATGACGCCG
CGTTTCTACCCTGTGGTGAAGGAAAGTCGACCTGTAGATGCCAAGGTATGAGAGCTGGGT
TTTGTGGGAAACGTTTGAATTATTTTACCTGCTTTTACTATTCTGAGACCCTGATGCACT
GTTGTTTGCCACCTTACAGACACCCAGGAAGAGAAAGACCCGGCACAGCTCCAACCCACC
CATGGAGTGCCACGTTGGCTGGGTGATGGACTCCAGAGAGCATCGTTCTCGTACCGCCTC
TGTCAGGTTAGATCTGACAAAAGACGTCTGTTTTTCCACTATTGGGCGTCTGATCATGTA
ATCTGAGTCTGAAATCATCTTGCAGCTCTAACGCCAGTCCGTCCGAGGGCACCCCTGTCC
TGGGCAACATTGGCTGCACGCCCCAGTCCCTACCGAAGTTCCAGCATCCATCACACGAGC
TGCTCAAGGACAACGGCTTCACGCAACACGTTTACCACAAGTACCGCCGGCGCTGCTTGA
ACGGTAAACATCTTCCTCTTCTAGCTGAATTCTTTTTGTGATAAATTTAATAGATTAATT
CTGTCAACCTTGACACTAAATCGTAGAGCGAAAACGACTCGGAATCGGCCAGTCGCAGGA
GATGAACACGCTCTTCCGCTTTTGGTCGTTTTTCCTCCGTGACCACTTCAACAGGAAGAT
GTACGAGGAGTTCAGGCAGCTGGTAGTTGAGGACGGAAAAGAAGGTTACAGGTGAGAGCC
CTTAGCAGGGAGGACTGCATGCCTGGCATATTTGGTTCAGCTGGATTCAGTTTCCCCAAC
ACCTTTTCGTGTTCATCGTATTGCAGGTATGGTTTGGAATGCCTGTTCAGGTACTACAGC
TACGGTCTGGAGAAGAAGTTTAGGCCCGATATCTTCAAGGACTTCCAGGAGGAGACTGTT
AAAGACTACGAGGCTGGTAAGAAATACCAAAAATGTGACTGTGGCTGGTTTGGAGGCAGC
AGTTTCAGACTCCCCAATCCCTTTGTCCACTGGCACTGATTGGAATTTGTCTCCTGTCAT
CAGGCCAGCTTTACGGACTGGAGAAGTTCTGGGCCTTCCTCAAGTACTCCAAAGCCAAAA
CCTTGGAGATTGACCCTAAACTGCAAATATACCTAAGCAAGTTCAAACGTCTGGAGGATT
TCAGAATTGACGTAAGTGGCACCTCCTCTGCAGTTAATCAATAGTTGACTGTAATACAAG
TACGATAAACTCCAGTTTTCCCGACAGTTTTCCATACTACCTTTAATTTAACAGTTCATA
AATTCAGCTTTTGATACGCATAAAACTCTAGTTATGTGATTTGAGTCATTAAATCCAGCT
CTCTTAGGTACTTTTGCATCAATATTAGAATATCACTCAATCGCCAGCCTAACTTATTGC
CTATCTTGGAGTCCAGTTTCTCCTGGGACAGCTCTGGGATTGTTCTGATACTGACTGTTT
CTGACTGCAGCCCCCCATAGAAGAAGGTGGTCGCAGGAGACACTCGTCCAGCGGGGACGG
CCGTCGCAGACATCCCTCCCAGCCCTCCAGCAGGCCCCACAGCCAGGCGGGCTCCGGCCC
CAGCCCCGCCCCCACTGCTCAGGGCTCCTCAGCCAAGGATGATGCCAAATCCAGCAGCCA
GAAAGCCCTCGCCAACGACCCTGCCCCAGACACCAAGACACTGAATTAACTTTACAACCA
AGTCCGCAAACATGGATTGACGCTCACCTACTTCTGCAATTTGCTGGTTCGCTGCACCAC
TGGAGGAGGGAGGGGATTTTTTTTTTCCCAACTTGTTTTTTGATTGCGGAATGACACATG
ACTAACAGGCTTATTTTTAGGTTTCGAACATGACTTTTTTTTTTTTTTTTTTGTCTTAAA
GAGGCAAGCAAAGGATGAGTTGGTCATAATCATCGCCCGTCCACACAGTGGATAATAATT
TACAGACTTGTCGTTTTTCTAAACCCCCCCTTTCATCACCAGTTTTTGCGCCAGCTCAAT
CATACTTGATTTCAGGCTCTGAATGATAATTCTTATAGCTTTGGCATGTGGTGAGATTGG
AGACTTGACAATATTTGGAATAATAAGGAGCATCTGGAAGCCTTGTTGGTGTGCTACACT
GTTCCTGACACTCAGCCGGACCAAAGTGGTGTGAAACAAGCGACTGACATTTCCACTCGC
GGAGTTCCGAGTCCCCTCAGCTGAGGGCAAAAAGAAAAAACTATTTCCTCAAAATGGCTG
AACATTGAGCAGAAAATATTAGACAACCACATAATCTATAAAAAGACTTGTACCGATCCT
TCAGTGTGTTCACGATCGTTGAAAGTTGCCTTATTTAGTTATTTTATTGCTTCTAACGTG
CCGCTACTTTAATGTCAATTGTACAGCGTTGAAAACAAACATCTGGCGCCATTTCATGCA
ACGGCCACTAGGTGGTGCCAAACGGATGTTCTTCCCGCTCCCTCCTGTTTGTCCCTCTCT
GGACTGTCTTCCAGGTTTGTCGGTCTGTTACAAGTCCTGTAATTCTTCCTTGTGTTTGAA
ACTCGTGGCTTTCTGTGCTAAAACCTCCTGGGGGGGAAAATGGCGCATTGGAATGAAGAT
TCATCCATTTTTATTTGGGTGCTTCCTTTTTTTTTTTTTCCCACCCTCCTCCCATCAAAT
GAGCTGCATCCATCCGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1093, 1232..1381, 8788..8862, 9192..9257, 9937..9954, 13284..13440, 13502..13513, 13857..13991, 14135..14287, 14968..15130, 15239..15383, 15762..15936, 16029..16204, 16377..16460, 16619..16945, 17813..17936, 18019..18224, 18319..18425, 18487..18662, 18746..18890, 18986..19095, 19203..19330, 19630..19836
1001..1093, 1232..1381, 8788..8862, 9192..9257, 9937..9954, 13284..13440, 13502..13513, 13857..13991, 14135..14287, 14968..15130, 15239..15383, 15762..15936, 16029..16204, 16377..16460, 16619..16945, 17813..17936, 18019..18224, 18319..18425, 18487..18662, 18746..18890, 18986..19095, 19203..19330, 19630..19836
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved