Takifugu_rubripes Locus RL7A_FUGRU
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes RL7A_FUGRU
Takifugu_rubripes
RL7A_FUGRU
scaffold_49
SNORD24, SNORD36, SNORD36
1165..1237, 1963..2035, 2241..2317
3983
AATATTTTACCGTAGCTTAAAAGCTGTAAGAATGAGTAATTATTTCTGAGAAAAAAGAA
TAAACACAGGCCAGCGTTTCACTGGCGGTTACTGATTCCAGACCGGCAAAAGCTACGTAA
CCACGTTGCAGGCAGGGCGGTATTTCCGCTACCCAGAATGCCTTGCTCTTCCTTTCTGCC
TGAACCGACATGGTGGGTACATAGGATACTTTCCTCTCGATTTTTTGAAGCTGTTTTATC
TCTTTCCATCCTTGTGCTGCAGCAAAGTCTTGAGTCAGATATTGCACCAGATTATTTTTA
GACTGTTGTTTCAACGTGTAATGTTAATATTGTCAGCCGATCTTGTTCTTTTATGGGATA
AAACTTGGTTGTAGTGACATTAGCTTAGCCGGTCTGGATGCAGTGGAGCCCTGTCGGAAG
CTAGTGCTAGCGTGGATAAACGTGCTTGAATTCGCGAGTTCTTTCAGCTTTATTTGCGTC
GTTTTTGGTTGAATGTGAAATCATTCCTATCACCTTAACACAATTGTGGTTGATATAGTG
ACGCTGTAAACATCGCATGTAAGGGTGTCTGCCAGAGGGGTTAATGCGATCATAACTAGC
CGGCTAACATGGAAGTTACTTCTGTTCTGTCGAATGTCGTAGGTACGTGTAGTTGCTGTT
AAGATTTTGTTAATCAAAGACGTGTCTAATGCGAATTTAAAATATTACAAAGCATTGATA
AGGGACTCATGCCGTCTTTATAGCTCTTAGAACATTTAAATGCAGTTTGCCTCATTTATT
GTGGCGTCACATTTCAACAGAAGGGCTATAATGTTCATTTTTTATTCTTGATAAATACGT
GTTTATTGGACCAATTCAGGGAAATCAGAATAAATAATCCGAGTTGCTTCCAAGCATAAG
ATGCTAAACCAAGGAATATTCTTGAATTGTTTCATGCAAATGGCCTAACTTCACAAGTTT
ACCTTAAATGACTAAGGAATTGTGATAAATGTTGATGCTTTTCTTCACAGCCCAAGGGAA
AGAAGGCTAAGGGGAAGAAGGTGGCACCTGCCCCTTCTGTGGCCAAAAAACATGAGGCCA
AAAAGGTGGTCAACCCCCTGTTTGAGAAAAGGCCGAAGAATTTTGGCATCGGTAAGTTCT
CTTCAGTTGTAAGAGAGACTTAAAGTGCATATGATGTAAACGAATATTTGCTATCTTAAT
GACGATGATGACAATATCCCACCAAGATCGCTGATGCACTTCAGGCTTAAAAGCAGACAG
ATTGTCATATTTGATATGATCACTCTTTGTTGATGAATTGCTTTTTGCTTTTGCAGGCCA
GGATATTCAGCCAAAGCGTGATTTAACGCGCTTTGTCAAATGGCCTCGTTACATACGCCT
GCAGAGGCAGCGCTCCATCCTCTACAAGCGTCTGAAGGTTCCCCCTGCAATCAACCAGTT
TACCCAGGCTCTGGACCGCCAGACTGGTAATTTTAAAACGAGTAATAGGGAGACTGAATT
TAATTTTAAATGTTGCATTTTTGCAATTTAGTTAATGGGAGATTTATGTTAACAGCTATG
CAACCATATATTTTTTTTTAACTTTTACTGAGATTACAATTCTTTGATTATTTTTCTGGT
TTAACCAATTGCACATAACAGCTGGATGGGTTTTAACCTTATTCTTTGATGTTCAGCCAC
ACAGCTGTTCAAGCTTGCCCACAAGTACAGACCAGAAACCAAGCAGGAGAAAAAGAAGAG
GCTACTGGCCCGTGCTGAGCAAAAAGCAGCTGGAAAGGGAGATGCTCCTACCAAGAGGCC
CCCTGTTCTCCGTGCAGGTTAGTTATACATAAGCCTGGTATTGTATTAATGTCAATGATG
GTAACTCAACCTCATCTTTACTGTAGTGATATTGTTGCCATCATGTAATGTCCTTTTTCC
AATGACGTACTGATTAGTGGTAGATCATAACTTCATGGCCATAATGCAGTGATGACTTGA
ATTTCTTCACCTGAAACCTTCAGTGATGCTTTTTGAGCTTTTTAACCCTGAGCATTGGCC
CAAACCATGTAAAAGCCAATGAAATATTTGGTCTATGATGTCTGAAGAGTGTTGTCCTCT
CTGTAGGTGTGAACACCATCACTTCACTGGTGGAAAACAAGAAGGCCCAGCTGGTCGTCA
TTGCCCATGATGTGGATCCCATCGAAGTATGAAGCTTTATTTCAGTGCAAATGAAGTAGT
TGAATTTAGAAAAGCGGTACCTGGCAATGATGTTTGAATTTCTTCACCTGAAGTCTCTAT
GTAGATCAAAACAGACGAGCTTTTTAACCCTGAGCAGGCACCAAAGTTCAAGTCTTTTCC
ATCAGTTTGTCCCTGTTCAACTACTCACACTTTCATTTTTCTGCTTTTTCAGCTTGTCAT
TTTCCTGCCAGCTTTGTGTCGTAAGATGGGTGTCCCATACTGTATCGTCAAAGGCAAGGC
TAGACTGGGCAGACTGGTGCACAGGAAGACATGCACTTCCGTTGCCTTCACACAGACAAA
CCCGTAAGTTTACGGTCAACGTGCTAATACTACAGCATGATACTGTTGTGCTAAGAATTA
TCCATGGGCAAAATAACATTTGTCATTGGGGAATTGATGTGTTTCATCTTGGTTTCTGCT
GTTGACGAGCTTTGTTCTCTTTCAGTGAGGATAAAGGTGCACTTGCCAAGCTTGTGGAAG
CCATCAAGACAAACTACAATGACAGATATGAGGAGGTTGGCACTTTCATTCTAACTGATG
GTGAAACATTTGCAACAAGATGGATCATTCTAACTCTTGATTCTTTTTTCAGATCCGTCG
TCACTGGGGTGGTGGCATCCTGGGTCCCAAATCCACAGCTCGTATCAACAAGCTTGAGAA
GGCAAAAGCCAAGGAACTGGCAACTAAGCTTGGATAAATTGTTTGGAATAAAAAAATGTA
TCCTAACTGAGCAAGTGTCTTCATTGCCATATTTATGTAGTACATTTGTATTTGAGTAAT
TTTGTGCCTTCAAGTGACTACAATAGACTAAAGTCCTTAAACGATCTTTTGAGGCTGACA
AATTTTGATTGTAAAAAGTTAGCATTCTTATTTAATGCAACTTGACAACACAAGACATCC
CACCAAAATGTTCAATACATTCGCAAAAATCAGACTTTAATTTTCTTGATGAACTTGGCA
AACCACATGTAAGAGGTTGCAGCACACAGGCCGTACCTGGGGAGAGAAAACATCACCTTT
ATGTGGCTCGTGATGGACATGTACAGCAGAGAGCAGCTACCCACCATGTTACTATGTACT
GCATGTGTTCGTTCCTCAGTGTGACCCTGGTCTGTCCTCCAATGGGGCCACCAGGAACTG
TGCTGCCTGCATGACAACATGGTGCTTGAACCTGTGCTCCATAAAAGGCTGTATCTTCCC
GCCCCCCCCCCCAACTTGAATAAATAGACCATTAAATGATAATGGACTTACTGAAGTCTG
CATCAACAAAGATGGGCTCTGCTCCTGTTACTTGACACATGGCCTCCAGGTCCCGGTAAT
GCCAATGGTTCCTCTCCACGTCATTGTTTGGTACAAAAGGTTTACGGGTCTCTGTCAGTC
TAACTACCCCAACCACCTCCATTTCACCCTCCACCTGCACAATAGAGAAGCTCTCTGTAG
GTCTACTGTAATTGTAACTGCTGTATTCATTGGAGACCGTTTGCTTTAAGGATCAAGAAT
GCCATTTGATTAAAAGGTAAAACTTCACAGGAAGAGGTGCAGTTAATAACCAGCAGTATG
TTATACAAGAAACAACCTAATCAGCACATGAGTCGAAGCATTTTTGAGTTCATCTAATCA
GGGTGTTCAACTGCAATACTGACCTGTCCCTTCATCCTCGTTTCTGGTCTTATCTTCTTT
TTTGGGACATATCCTCTGTTCACCAGGATAGTTATACTGAGGGTGGTGAGAGAAAATTTC
AATCAGATCAAAGACATTTATTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1130, 1316..1465, 1676..1816, 2106..2185, 2392..2522, 2665..2734, 2812..2912, 2980..2983
1001..1130, 1316..1465, 1676..1816, 2106..2185, 2392..2522, 2665..2734, 2812..2912, 2980..2983
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved