Takifugu_rubripes Locus NCL
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes NCL
Takifugu_rubripes
NCL
scaffold_43
SNORA57, SNORA75
4078..4214, 5503..5629
7190
CTAGCGTTTGAGCAGTGAGTGTCGCAACAAAGGCACTAAAGAAGAAAGAAAACCCGAGA
CATGGCCTCAATTAAAGCTGTAATAACATAGCGAAACGTGTTTTGATCAAAAATAAAGTG
GATTAATTGACCATTTTTAAACTATGACAGACTGGTGAAGCTGTGCGTAAAGTTACACTC
GGATTAATCCGGAGTAATTCTGGAACTGCAGCCGGATAAAGGGTTCTATAAAATGCAAAA
ATGCAATATAAAGATCCAGCCCTTCAAATTTAAATGATATACTTCCATTCCTAACTTTAT
AGTGCGAAAAGGAACCATGCTTGCATTAACGACTGGAGAAACGCGCACCCCTGGTTTGAT
GAGATGCTTTATTAATAATATGCTATTTGATTCTAATGTATCATGAATAAACTGCGAGCA
GTAATCCGGCACCGTGGCCAGCCTGGTTGTATAGCGCTGCACTTTCATATTCAGACTTTA
GGACATCTGCGCCCACGTTTGTGTTGACAAAACGCACCTTTGGACCCCTGGATGAATAAA
ACCGAAGGCTCCTCTACGGCTAATTCACAGGAGCTGGAACGCTCTGGTTGTCGTGTGGCA
CCGACAGACATATTGCTTCAGTACTACCGGCCACAGGTTGTTCATGGTTCCACATGTGTG
GGAACCACGTGGCTGGTGAACAGCTGCTGGGGTGTCGAAAAAGGGGACATTGTGCAGAGT
GGGTGACCGCGTAAAATCCTAGTCTTGAATTAGTCAAAATCATATATTTGTTTAAATTAA
AATGCCTGGGTGAATGGCAAGCAAGGGGACTGGTCACACGCTGCCGTCATCTCATGTATT
CATTAATTCGGCTTATGTGTTTCCACATCTCCGGTGTGTGGAGGCGAAGCGCGGTCACGA
TGAAAACCCAGCTGCTTGTGATTGGTGGAAACGGCCGTGTGGGCGGGCCAACGCGAACGC
GCAGAGCAGGAGAGTTACGAGTGTGTCTCAGGCTTATCTGTCTTTCCTGTCCAATGTCCC
GTCGACTAGGTTGAGCCACGTGTGTGTGTTAGAAATTTAGTCAGTCGTCCCAAAACGTCC
AGTTTCTTGTGTTTCATTGAAACACAGAGCAGCACAATGGTGAAGCTAGCAAAGGTAAGA
GCAGAGGTCGTGATTTCGCGAGCTTTTTCTGCTGTAACGTTCAATCGTTTATGCTGTGTG
CGTGCACGAGGCCTTTTGCGCAAAGTTGCTGCGAATCGGCAAAATAAAATAGATTTACGG
TTGCGATGGTATGGAACATTTTACAACGGGAAGCACGTTAGTTACGCGGTCGATTGGTGG
TGCCCTCGCAGCGTTGCGTGTACGAGGGACAGTCTTATAGCAACGTTCTTCGTTACAGTC
CTCCATGTTTGCTTTCAGGGTTTCCGGCCTGCTAACGAAAACCGGACGATTCAAAATGGC
ATTCGTGCGCGTTCTCGTTGTTACGACGGGGTCCGAGCTACGCACTAGAAATAAAAATGT
TTAAGATTCTCACAACATCGTGTTAGTGAAAAATGTGTTCGGCCTAAGAATATTGAACGG
GTTAGTCAGTGTAAGCTCTTAGTCTTAATGTCTTACTGCGACGCCTGTTAGCATTAGCAT
TGGGGTTAAGGATGCACATGCATGGTTGGAGCCTGTTCGGGGCCTTATTAACGTTGCTGT
TTTGTTGCTTCCCACTGATAGCGCCACCACTTAAAACTCAAAACAGCGTATTAACATGTT
TCCGTAACCTCATTAGTTTGGCACATGTTGGATTTGTTTAAGCTCTAATTAGCCGACATG
CTAACTGCTCGGCCTCTCGCTCCACGTGGGTTGTACGTTTGCGTTGAGTGACACACGAGG
TGGACCCCAAAACTGATTAGTCCGATCCGCCCCTACACTGTTTTCTTCGTAATATTATTC
AATTAAACTGAGTTAATGTGTAACTTGGTTAATATTTTTCGTTTTTCTACGTTTTCTGAC
GCTTTACAATATTAAATGTCGACTAATGCATTAAAAGTAGCATGTAGAATAGCCCCCCCC
CCCCCCTCCCTAAAAAGTACCTAAATGTTATCTTTGATCAATGTACTTATTTTGTTTTTT
AATTTTATTCCCATGTAGGGAGCAAATAAGCAAGCAACTCAGAAGAAAAAGGCACCTCCT
CCTCCAAAAGAAGTGGAGGAAGAATCCAGTGAAGAAGAATCCAGTGAAGATGAAGAGGTA
ATATTCACATTCAGACTCCTTTGGGCAGTCACATCTGTGGACATTGAAAGTAACTAAAAT
ATGGTTTGATTTTATGTTTGTAGACTCCTCCTCCTCCTCCTAAGGCTGTGAAAAAAGCAG
CACCAGCGAAAAAAACCCCAGTTAAAAATGGAGTTGGTGCCAAAAAAGCTGAGAGTGAGG
ATGATGATGATGGTGAGTGGCTTCCTCACTTTATACAATGTGAACTGCAACCGTGCTTTC
AGTTGTGTTGTAGTTGGTGCTTTGATCACTAGGGGGGGTAGTTCTGTCATGACACACTAC
AGTGCCTACCGCAGGTTTAGATGTGATCTAAACAGTTGTACATTATAAAGATTTAGACCA
ATAGAATGACTGTTGTAGAGTGGGTTAAACTTGCTACTTGGTGGCAAAATACTGTACTGA
GCAAGTCTTTCCCTCAAAATTCCACAGAAGAGGAGTCTGAAGAGGAGGCCCCCCCACCGA
AAAAGACTCCTGCAAAAGCAACACCTGCTAAATCTAAGAAAGCCCCCGCAAAAGCTGAGG
AGTCTGACGATGAGGAAGACGATGAGGATGGTAAGATCACTTTTGACACCTTGTTTGCTG
CAGGAAGTTGGTATGTATGTTACTGTCGGTTCCATCTTCATCGGCAAACTTTGTCACCTG
ACCAGAAGAGTCTGAAGAAGAGGCTCCACCACCCAAGAAAGCAGCCAAACCTGCAGCTAA
GCCTGCTGCGAAGGCAGCTGCAAAGCCAGTAGCAAAGGGCAAACCTGCCAAAGAGGAGTC
TGAGGATGATGAAGATGAAGAGGATGACGATGAAGAGGATGATGAAGGTGGTGAGGCTAA
CTTATTTTGGCATTCTTGGCAGTTGTTGCACAAAGTGACTGCCAAAGGTTTGCCATGTAA
ATGATGATCTCTTAGGGACTTAATACTGATTCCGTATGATGTCATGAACAGATCTGATGC
TGGTTAAGAGCTGGTGGTGAGAAGGTTGGTTGTTGCCGGAGTTCCTTATGAACCCTTTTT
CTTTTCTTCAGAGGAAGAGATGGACACCACTCCTGCTCCAGCCACAAAGGCCAAGAAGGC
AGGCATGGTGAAGGCCAAAGAAGAGTCGGACGAGGAAGATGACGAGGAAGATGATGAGGA
GGAGGAGGAGGATGACGACGAGGAGGAAGAAGAGGAGGGTGGGTTTTGTTGATTAAACAT
CTTATTGATGTCTACTTGTCTTGCACAATATACAATTTTCTGGATTATTCTAGTGTATTA
AGTTTGGCTCTGTTTTTGTTTCCAGAAACCTCCAAACCTGCAGCTAAGAGGAAAGCAGAG
GCCAAGAAAGAAACGCCGCCCGCAAAAAAGGCGAAGGCTGACGGTGAAGGTGGGAACTGT
GCTGAGCTGTCGTGATTGACTGGCTTTGGTTTTAACTGGTTAAAATGCATCAACGCGTTG
CTTTTGCTTTCTCAGGATTTTCACTGTTTGTCGGAAACCTGAACTCCAACAAGGACTTTG
ACGAAATAAAAACAACACTGAGGAAGTTCTTCTCCAAGAATGATCTCGAGATTGCAGATA
TCCGGTTAGGCAACTCCAGGTAGAGTCTTTTATCGAGGTTTTGATGTGTCGATTCCCTCT
TTGCATCAGTTTTGCAACATTAAACCATTCTTGTGTCCCTTTGTCCCACAGGAAGTTCGG
CTATGTCGACTTTTCATCTGAGGAGGACATGCAGAAGGCCATGGAGCTGAACGGCAAGAA
GGTGATGGGTATGGAGCTGAAGCTGGACATGCCGCGCAGCAAAGAAACCACACAGGAGGA
CAAGAAAGGTAAAGCCCTCCCCCCCATGGGGCAAAGATTCTGGAAATGACCCCCAAACCC
TCTATTTCTTGGCATGCATGAGTTGTTCAGTACTCAGGCGTGTAATGTACGGAGGAAAAT
GAAGTGCAGTGCTATGTCTTCGGTGCCGGTGCGTTTTCAGGTCTGCCGGTTCTATCCTCA
ATCACTGTGACATTATTTGACTGTGAGGACTTTGCCTCTGTGTTTTCTGACCCCTCAAAA
CTAATCGTCCGCGCTTCTTTTTGTCCACCAGAGAGGGACACGAGGACTCTGTTCGTTAAA
AACCTGCCATACTCCGCGACAGCGGATGATCTCAAGGAAGTCTTTGAAGATGCGGTTGAT
ATCAGAGTACCTCAAGGCCAGAATGGCAGCAACAGGGGGTAAGAACACATCGAGGTGCCA
TGACTAAACGTGCATTTACCAGCAGGGTTTCAGGGTGCACACACGGTTGTCTGGTTCATT
GACATTTAGACACATTTCTTTTGTCCTGACAGCATTGCTTACATTGAGTTCAAAAGTGAG
GCTGAGGCAGAGAAGATGCTGGAGGAGGCCCAGGGAGCTGACGTCCAGGGGCGTTCCATC
ATGGTGGACTTTGTTGGAGAAAAGAGCCAGAAAGGGGCCAAGGTGTCAGGTAATCAAATC
ACTCAACCATTATTGTCCTTGTAGTGTTTCAGCCTCATCTCATCAGTCTTCTGCTCTCTC
CTGCAGCATCAGGGGCAGCGAGTAAAACACTGATCGTGAACAACCTGGCATTTAGTGCTA
CAGAGGATGTCCTACAGTCCACGTTTGAGAAGGCCACTTCCATCAGGATTCCACAGAGAG
ATGGTAGACCTAAAGGGTGAGTCCTGCACTGCACCTTCTCACAAGCTCCTCTTCCGTCTC
ACCCGCGGGTCTGCATGGATTCACGCAAGGAGCGCGATGCCAGGTGGGCCCCCCATTTCT
AAATCTGCGTCTGCCTCAACAGGTTTGCTTTTGTGGAGTTTGAGACCGTCAACGATGCCA
CCGACGCGCTAGAAAACTTCAACAACACAGATATCGAGGGACGCTCGATCCGGCTGGAGT
ACAGCCAAAACAGCGGCAGGGGAGACGGCGGCAGAGGAAATGCTGGTAGGCGTTAAAGTC
CAAACACTGGCGTTCTAGCCAAACTGGCTTTATAATGGGACCAGATATGATGAAATCTTG
TCATCCAGAAACCCTGTGAGGACTCAGAGATAGTCAAGTCCTGATCTGTCCCGATTCAGC
ACATCACTTGTTTGTCATCATACCAGTGAATGTAGTTCTGAAAGTGTTCTTCCTGCCACC
AGGTCCAACCAAAACACTGTTCGTCAAGGGTCTGTCTGAGGACACAACAGATCACAGCTT
AAAGGAGGCATTTGATGGGGCAGTAGCAGCCAGAATAGTCACTGACAAAGATACCGGCTC
CTCCAAAGGGTGAGTTTCTCCGGTCAGGTCTTGACGCTGCCGGCTCTTCTCATGAGCACC
ACTCTGTCTATCGGTGACAGTGAATGGATTCGCAAGAGAAGTAGAGCAAACTGACATTTA
CACTGGCGCTTTCCTCAGTGGAAGGTGCCCATGTCTAATGTGAAACATTTAACAGAACCG
TTGGTGGGCGGGGTCTGGGTTCTCGGGGTTCATCTCCTGACGTTTTGTCTGGTTTTGGTT
CTACTTGTTTAGGTTTGGCTTTGTTGATTTCGACAATGAAGCAGACTGCAAGGCCGCCAA
AGAGGCCATGGATGACGGCGAGATCGACGGCAGCAAGGTGACCTTGGATTACGCCAAGCC
CAAGGGTGACGGCGGCTTCCGCGGTGGCCGTGGCGGCTTCGGGGGACGGGGTGGTGGCTT
CGGAGGACGTGGGGGAGGCTTTGGCGGAAGAGGCGGTGGCTTTGGTGGACGCGGTGGTGG
CTTCGGCGGGCGTGGCGGCGGCGGCAGGGGACGTGGAGGTCCTCGTGGAGGTGGGCGTGG
GCGTGGCGGTTTCGGAGGTAATTAAGGTCTCTTTTTTTTTTCTTTAAAGATATTTTCATG
TTCCCTGGCCCTCAGGGTGAATAAGAAATGACTTTTTATATATATATCTTTCTGTTCTCA
TTTTAGGTGGCAGAGGTGGTGGCGGATTTGGCGTCAAACCCCAGGGAAAGAAGATCAAGT
TCGATGACTAAACCTTTAGTCTATTTTACTTTTTCAATGGACTCTGGTTTCATCACTTTT
CAGAGCTTTTGGACATTCCAGAAAGCATCGTGGATTATATATTTAACTGTTAATGGGCGT
TTTTGCCCTTTATTTAGCCTCCATTATACCTCCCCTCCCCATGTGTGCCAGGCAGGTACT
TTTGACCCTCAAAGTGCTATTTATTAGTACTGAATGTCCCTAATGCAAATCTGCACCTGT
TGCCCACATTAGCTCGAATGTTTTGTTTTTTTTTTCTTTCCAGGAAGTGAAATGAAATGG
GTCTGACAAATGTTTGCTGTGAAGATTCTGCTCGGCTTTGTCAGATACATTGTGTAAATG
TAAACAGTTTGTATGATTTACTTTTACCTTTTGTAAAAAAACAAAAAAAAACAAACCACA
CACCTGTATCCATGTTTGTTTTTATTTTGTTTAGTTTTGCGTTAGGTGCCATGTTTTACT
GTAATGTGCAAAGCATATTTTGATAGATTTAAGTCCATGCTCTGCAGTTGGGTATTAAAT
GTGGCAAAGAAGTTTCTGTCGTGTTGGACGGGGCTGGGAGGGGGGCACAATCAATGCGGG
GTCGCAGTGGATGATCCTGTTATGTATGTAACAAAATGTTTGTAGTGCGCTGACTAATCT
TTTGCCATCTGGAAACCGAGATTTTCACAGGATTAAATAAAATCTTGTAGGTAGTGATTT
TTAAACGTCTGTCCTTGTGCAGTCTGAATCATAGTGTAATAGTTCACTCTTCCTCTGCCG
TCCGCTAGGGGGCAGTCTCTGCGTAATAATGGAGGGGCTGAGCGCTTTTACGCGTGGGGG
AAGTTTTCTTTGGTTTAACTGGAAATATTTCAAAATCCATCACTCCAATATTGGCCCTAA
AAGTGTTTATATTTAATATAAATGTTGACATTCAAATCTCGGACGATGGCATCTACCCAC
GAGTGGCAGGTAGTGTGGCACCCACATGATCAGAGAACATGAGCTGCCAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1133, 2118..2216, 2303..2471, 2598..2789, 2885..3042, 3253..3397, 3505..3588, 3675..3798, 3891..4027, 4291..4417, 4532..4668, 4746..4875, 5002..5144, 5342..5468, 5712..6016, 6126..6190
1116..1133, 2118..2216, 2303..2471, 2598..2789, 2885..3042, 3253..3397, 3505..3588, 3675..3798, 3891..4027, 4291..4417, 4532..4668, 4746..4875, 5002..5144, 5342..5468, 5712..6016, 6126..6187
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved