Takifugu_rubripes Locus RPL17
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes RPL17
Takifugu_rubripes
RPL17
scaffold_27
SNORD58, SNORD58, SNORD58
1218..1285, 1843..1908, 2449..2515
3661
ATGAGGAATTTGTACAGACACTTATTGACACGGTCCTCTAGGAGCTTCGATCCTGAAAC
CGTGGGAAGAGGTGGAAAACTGCATCAGGTCTTTTTCCAGGCTGTTTTTCTTTTAATTAT
ATTTCTGGATGTATCTCACAAATGCTGAACTCTGTTGGGAGGACTTTTTTTGTCTGATGT
AAATAATATCTTTATTTTTGTATGTTGACCCCCTCCAGCTTGGACATTATTTACAGTGCA
ATGTTGTGCCTGACTCACGGTGAGAGTGCACATAAGGTGGTTTTTTTTTGTTTTTTTGTA
ATGTAGCTAAATCCAACATTTCACAGTGCAACATGAAATACCAAATAAAAATAAACCAAT
AAATGCTTTAGTACCACTCTAGAGTGTTTATTAATATTATTTATTAATACTGCGTTGCTA
TTACTGTCTACTGGTAATTATTTCCCAGCTTTTTCCTCTTCAACTTTACCGGACCCTCCA
GTATTTACTAATACTTATTTACGCAGGCTGCAGGCTTCACAAACGCTAAATATAAAGTCG
TTTTATAGTGCAGATGTCGCCATCTAGTGTCCAAATAGCGTCATTACATGCTTTTTACAT
TTCCCCTCCCATCCTGCAGGGGGCAGTCAACCCCACGAGAATCAGAATAACCGCAGCGTT
GCCCTCGCTTCTTCCTCTTCCTTCTGCGGCCTCAGAGGTAGGAGACTAGTCCAGCATATG
AAGACAAGAATCTATGTTTAATCTTTACTAAATCTTTACCATCCTGCTTTCACGGCGTTG
CTGATCTATACATCAGTGTTAGACGCATCAAAAGATGTTAGATGTTTCGATATAGAGCCG
GCGTTTCAGTTTTAACTGGGTTTTTGTGAGGATGCCGGTTTGGTGGCTTTCGCGTCATGG
ATCCGCCATGTTGGCACGATTAGATGATAAATTAACTAAATTAAGACTTCTTTACTGTTT
AACCTGGGTTCTATGGTGTTACGTCTGCTCATAAAATCAATCGTCTCGGTGGCAATCGCG
ACATTTGGGTTGCGCTGCCAACTCAAGCTAATGCTAACGTGGCTAACATATATACCAACC
TTGGGAGTTTTCCTTGAGTACTGACCACATGTTTCTCTCCCCGCAGATATCTGAAAATGG
TCCGCTACTCTCTCGACCCCGAGAACCCGACGAAATGTGAGTAAATGTTGAGATTCATTT
GCTAAAACCTTTGCGCGGATGCCGTGATGACTTCTTAGGACACCTTTGGATGATCCATGA
AAATAAAACCGAATAACCTGAGCAAACACGTGTTGCAAGAATATTTTTATGTTATTAGAG
CTCCTTCTAATACTTCACATGTATTTCAGCATGCAAGTCGAGGGGCTCCAACCTCCGGGT
TCACTTCAAGGTAAGATCTTTTTGACATTTGGTCCTATTAGGTTACTAAACCTCAGGTTC
AGGTATTTAAAACGATGTTTTCAAGTATCCATTTAAACTACATGTCAGTTGCTAGAATGT
GAGCCAGCTGTTGTGTGTATTCTATGTACTGTATCATTACCATTCATTTAAAACTCATCA
CAGCAGATTCTGAGAATGTCCCCTTTCCATCAGAATTCCTCACCTCCTGCCTTTTCTCTG
TGCAGCTGTAGCTGATGTTTGCTTGTTTTGACCCACCAGAACACCCGTGAGACAGCCCAG
GCCATCAAGGGCATGCACATCCGCAAGGCTAACAAATACCTGAGGGACGTCGTCGTCAAA
CACCAGTGCGTCCCCTTCCGTCGCTACAATGGCGGCGTCGGCAGGTGTGCCCAGGTGGGT
TCAAGGAGTTCTCTTTAAGACAGGTTATTGGTGTTTGAGGAAGCTGCAGTGATGACCATC
TTAGGACACCTTTGGATAAAAGATGAAACTAATCATTTGTCTGAGCTCCTTCTGAGGACA
CACTGACTCTTCCTGTCACACAGAAATGGCTGCTGACATTTGTTTTCTTCTCTAGGCCAA
ACAGTTCGGTTGGACTCAGGGGCGCTGGCCCAAGAAGAGTGCCGAGTTCCTTCTGCACAT
GCTTAAAAATGCTGAGAGCAACGCTGAGCTGAAGGTACGGCAACACGTTTCTTATTCTAA
GGTTGTGAATCTCGAGGAAACGGGAAGTGTTTAACTTTTTGCTGTTGCGAGGCATATTTG
GCCCACTCTGGTTCTCACGGGTTTTCTGGACGGGTTTGTTTCCAGGGCCTGGATGTGGAC
TCTCTGGTCATCGAACACATCCAGGTCAACAAGGCCCCCAAGATGAGGAGACGCACGTAT
CGCGCTCACGGCCGCATCAACCCCTACATGAGCTCTCCCTGCCACATCGAGATGATCCTG
ACCGAAAAGGAGCAGATCGTCCCCAAACCAGAGGAGGAGATCGCCCAGAAGAAAAAGGTA
CGAGTGCGTGGGCGACCAGGGCGTCCAGACGGGCCGTGTCCCACAGATGTTGCACTGATG
ACCACTTAGGACACCTTTGGATGAACCATGAAAACAAACCGTTGAACCTGAGCAGCACGC
CTGCGCTTTGAACGGGCGCCGTTTCTGCCCGTGTGGCCACTAACGCTGCGTTTGCTCCGC
AGGTTTCACAGAAGAAGCTGAAGAAGCAGAAGCTGATGGCACGGGAGTGAATCTGAATAA
AAGTCAACACTTGTTAATAACAGTTGAGCGTCGGGCTTCTTATTTTTACGCCTTTTGACC
AACTCGGCTGCTGAGATCTTGAGTGAACTTTAATATCAAACGCTCACAATAATGGGCAAA
TTTAGAGGTGAATAATATCCACAATGTTTCTTTCTGTTTAGAATAAAATTGACCACTGGG
TTTTTCATTGTCCTAAATTTATGATCAGAATTTCAATGCACTGTTCACCCACTTGGAGTA
AATGCTCATTAAAAAACGGCCCTCGTTGGCCATAATTTTTATACAGGAAATAGGTTTGAC
CAACGCAGGTGGGAACACAGGTGAATATTCCTGGAAGGTCAAAAAACGCTGGTTCTGACA
GCCCTGTTTAAAAGTAATGTGCTAGTCTTGGAGGATATGTTCCCTGGTAAAAATTGCTTT
TCACGTATTGCAAATAAGTTAAAATATTAAATGTTGGTTACTACAGTTTTACGGTGCTTC
GTGGTCATGTGTTGCCCCACATTCCACAAAAGAACCCACTTTGCAATATCTCAAAGTTTG
AATTTTTGAGAATGATTCAGGAATCTGGGCGGATTCGGTTGGAGATTAAAATAAATAGAT
TGGAATTGTCCGCGACACCTCAATTAGATCGTTAATTGATGGTTTTCTTGGCGTTGCAAT
CCTTCAAATCACCACGGGGGGTCGCCATTGTTCCAACGTTTGGCCTTTACTGGGGCAACG
CGCTTTTCTCATGGAGAGAACAACACGATCTCCCACTGATAGTGAGAGATTGTCACAATT
ACACTAATTTTTATCACAGTAAAATAATTGATACGACACGATCAGCTGAACTAAAATAGC
GACGTTGATTTTTCCCTCTTAACCGTTTTAACCTTAACAAAGGGACGCTTAAATCATTAG
GTGATAAATAGCAATGTCAAATCTTTTGAATTAAACTGCGTTAAAAGTGTATTGAAAGTG
CCTTTTTTGCACTTAGAAATACAGTACAAACATTTCTGTTTGGTGGTAGATTTTACTTTA
CA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 1126..1175, 1349..1389, 1659..1793, 1975..2073, 2205..2396, 2582..2661
1001..1023, 1126..1175, 1349..1389, 1659..1793, 1975..2073, 2205..2396, 2582..2626
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved