Takifugu_rubripes Locus RPS11
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes RPS11
Takifugu_rubripes
RPS11
scaffold_15
SNORD35, SNORD35
1669..1751, 2394..2477
3671
TTCCACGACCTGATCTTTAGAATTGCCTGTAAGATAAAAGTGCAAATTTTCATGACTCC
ATAATTGAAGAAACGACAGTTTTCTATTACTTTTCTTTATCACAGACATCTTGTGTTGGA
GTTGAGTCTCTTCCTATCATTTATGGTAAACTATTGGAAGGTGTACACACTGGCCTGCCC
TATACGTACACGTTAAAGTCTGCATTTTAAAATATTACAATATTTAATTTGGTATGTATC
GTTATTTTTCAAACCCCAAAGTTCGGAAGGCGGCTAGGACTGAGCTAACTAGGAGTCCTC
AGTGTTAAAGTGCTAATGGCTTGCTAACGTGGGCTAACGTTAGCTATCTTTTCGACCTGA
ATCCAGTTGTTGCTGCTCGAACGTGTATAGGTTAACAAAATCTCGAAACATGGTAATTGT
TAAACTCCTCCATGGTAGTTGTTAAACTCCTCCATGTACACATCGACTGCCGCAACAATG
ACACACGCGTTTATTTGTTCAGAATTACAACGTTAGCCCAAACCTTGATCGCCTCCTCCT
GGGTGCGATGCCATCTTGTCCGCTATTCCGTCCAGACACTCGTGTGACAAAAGTGTATCG
ATAAGACAAACGTATGCTTTCCTCCTCTGACCGCCGACGCCTATATGTTTTCAGATGGGT
GGATTGGCCGGACTGGTACGAGCATATAGCGCTAAAACAAGTGGCGGTGACATCATCGAG
CACTGACGGCGTTGCGTTCATGTGACGCTCACTACGGTCTCAAACTGAAAGTACATTTTA
TTATGACACTTATCTCGGGAGCAATGAACGTGTTATGTTCAGGTTTTAGACGTTCTTTCT
ATTATTTGGGTCGGCGTTAGCCGTTGTTTTCGAGGGATAAATACATTTTTTTAAAGTTGT
TGTTTTCCGGTAGCCTCGCCTTTTAAGACGTCACTTCCGACATCGTGCCGTCTTCCGGCC
GTCGCGCGCATTCGTAGGCCTCTTTACGACTCGGCTGGCAAAGATGGCGGATGCACAAGT
ATGTGAAGGAAAGCGGCGTGGTGTATTTAAATCGACGTTTTTAGTGTCAATAACTGTGTT
TTCTTATATGTATACCGGATTTATGCTTTTATGTTTTGTCTGTACGTTGTCGTGGGCGAA
TTCAGTGCGCTTAAAGGCTTTACTTTTAGACTTTAGCCGTTGCCCTCGTACCTCCCTCGT
GCACCGATGAGCTAACTCGAATGCTAACATTGTTAGCTTAGCTTGAGTCAAGAAAATGTG
TCGATAATGGCTGTTAAACTACCTGCAACATGACTGTTTTTGAACTCGCGACTTATCTTT
TTCATTATATATACTATACATATTGCACTATTTCAACCATGTGTGGGCGTTGGCAGATTT
TCAGCGGTTTTCTCGCCTCGTCCATGAAGCCGACCTAACATCTTGGATCTTTTCTGATCT
CCAGACCGAGCGGTCTTACCAGAAACAGCCCACCATATTCCAGAACAAGAAGCGTGTTCT
GGCAACCGATGGTGGCAAGGAAGCCAAGGAGAAGCTCCCCCGTTACCACAAGAGTGTCGG
GCTGGGCTTCAAAACCCCAAGAGAGGTGAAAATGAATCAAAATTACTGCTCGATAACAGG
CACTCCTAAAGCTTTACCCCTTCACTGTATATTATTGTAATACTTCACCTGCAAATGATG
TCTTTCTCACGATGGTCTTCCAAACCGCAGGGTTCTGACGACACTGCCTAATGGCAATAC
TGATGCAGTCAGTATTTACAGGATTGAGGACATTATCCATGCATGCCCCATTGACACATG
TTGCCCTTTGTTTCCCCCAGGCTATTGAAGGCACTTACATTGACAAGAAATGCCCCTTCA
CTGGAAATGTCTCCATCCGTGGTCGGATCCTCTCTGGTCAGTTCAACGCGGTTCTGACTT
CATGATTTTGTTGCCATCACAACATAAGTCACTATAAATGTTTCTTGTTCTTTCTCGTCA
CACCCCTGCAAATGATGTTTTTAATCACGATGGTCTTCCAAACCTTCTGGGTTCTGAGGA
TAGTGCCTGATGGCAATGCTGATGCAGTGAGGCGGCAGCTGTTGGTGCTTGTATGTATTA
AACGTGAATGTGAGTTTACACTAACTGATGCTCTTCTGCAGGTGTGGTGACCAAAATGAA
GATGCAGAGAACGATTGTAATCAGACGTGACTACCTGCATTACATCCGAAAGTACAACCG
CTTTGAGAAGAGGCACAAGAACATGTCTGTCCATCTCTCACCTTGTTTCAGGTAATCTGA
AGTGTAGTAACGGGAGGATTATTTTATTGAGCGACGGTGTACTCAAAGGGAAATTTTAGG
GTTGTCCTCTTGAGAGCCAATGATTTAGTCTGGGTAGGTTATGATTTAATTAGCTGCAAA
TGATGTCTTTCTCACGATGGTCTTCCAAGCTCAAGATGCTCTGACGACACTGCCTTTGGC
AAACTCTGATGCAGCGTTAAATCGCTGACATCGTCCTGGTCTGCAGCTCCGCCATCCCAG
TCGCTAAACCCACTTTTTCCTTCTGCAGAGACGTCACAGTTGGCGACATCGTGACTGTTG
GAGAGTGCCGACCACTCAGCAAGACTGTGAGGTTCAACGTGCTCAAAGTGACAAAGGCTG
CTGGAGCCAAGAAGCAGTTCCAGAAGTTTTAGATGTCTTTGGCCAGGACGGCTCCATTTG
GCTAACCTGATTCAATGGCAAATAAAGAAATGTTGTTTAAATTGCTCTTTGCAATGAGTG
TTTTCCATATTTCGAAATGCTTTGTGCATTACTGTGCAACATTTGCTTCAATGTTAAACA
TCATGAGAGAATCTGAACCCAGGTTCCAGCCATCCATGAAGAACCTGGAAATTTCAGAAT
TTAATGGCCTTTTCTGTTCCAATAGGGGGGGGGGGAAATAATCACATTTGGTACAAAATT
GCATGTGCATTGTCATGTAGCCTCATTGTGAGTAATGTGACCAGAGGAGAAACTGAGACC
CTTTAGAATCACTGACCAAGCAGAAAAGTTATAATTTCATGTTGATTAAGGTTGGAGTGG
TTGATGGTAGTGCGTATCAAAGTAAAATCAGCTTTTCCATAATTAAATTCAAGTGTAACG
GTAACAAACTTACGTACTCCATATATTACTTAGAATTTTGCTTAATATAGCTTAAAGAAA
ATAAAAAATTAGTGTCTTAGAATATAGAACGCTAAGACCAAAGCTATTATGCAAACATGT
CAAGATGTATGAACACACACTGCACTTGGTCAGGGCTTGACTGCCTTATGGAATGGAGGC
AGCATTGCTGAGATGTTCTGGAAGCCCGGGTTGCTCTGATGGGAGCCTCCAGCTCTTCTA
CACGGGTTCTACACTTTAGGTGAGGCGAGTAAACTGGCCAGAGCACACACACATGTCCTG
ATACCAGGCACAAAGGTAGACTAATGAAATAGTTAGGATTATATTATGATTCTGCAATAT
TGAGCATTCCTACACAATATATTTTAGTTTTACTTTCGGACTGAAATAAATCAGCCTTTT
AAATGACTTTCTAACTTGACAGGCACCATTAGATTAGAAGCTGTTCTAAAATATGTCCAG
CAGATGGCGACAAAGACTTCGAATGAACCAGCTGTTCATCATTGTTTTCATCATTTCAGT
TGCATATGAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1017, 1444..1584, 1820..1895, 2141..2270, 2545..2671
1003..1017, 1444..1584, 1820..1895, 2141..2270, 2545..2668
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved