Takifugu_rubripes Locus ENSTRUG00000007902
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes ENSTRUG00000007902
Takifugu_rubripes
ENSTRUG00000007902
scaffold_3
SNORA30
2481..2616
7946
TTTTTCTCTTAATGTGTCCTTTATTACTGGTTCCATCCTTGGTTGCTGAGTCTTCCTCT
GTGGCATCAGTCATCTCTGCATCATGTTGCTCAGGCTTCTCATCGTCTTTTCCTGTTGCT
GCAGATTTGTCTGTGTCTTTTACACCCAAAGCTTCTATGCCCTCTCTCAGGGATGAATCT
GTGGCTTCAGCCTGCATCCTTCCTGTCGTTGGTGGAATATTTTACAGCCAAAGCATCTGC
AAAGCAAAAAGTTTAATGCTTAATTGAAAGAAACAAACCACAACGTATACGTGACCCATC
TTCATGAATGCCGAAACGACGTATGAGCAGCCCTGTAACCAGTAGCGTTTAATTTAACCG
AATGAAAGACAAGACCAATAAAAAGTGACATGTGACATAGGTCGATATGCCGGCTAACGC
CAGATCTAGCCAGTAGCCCCCTACAGCCCAAAATACATAAATTGACATTACCGAATGTCT
ACGTTGACGTAGGTCACCGGGGTTGCACCAAACCGCCCTGATTAAAATCATCTAAGTTGT
CCGCGGGATTTACCAGCCATAACCAATTTTAATTTACGTAGACTATGGATTGTAAATATA
GTCAATTGTATGAACGTAAACATTGCGCCATTTTGGACCGAAACAATCGCGTGACGTCGT
TCTCGGTTCTGCGAGACTGCGCGCAAAGTCTCTCGCTGATTTCAAAGTATATGGATTATC
AGCGGAACCGGTGAAGCTCGGCTAGCGGTAGCATTGTATGCTATATAGATCTACACATGG
ACCAAACTGCGCTAGTGCTTGTCACCGTGACAAGACGTAATGATAATAAGGAAGAGAGTA
ATGTACATTTTTGTTGCGTGCCCCTTTTGCAAACACATTTGAATTTTTACAGCGAAGGTC
CTGTGTTTTGAAAATCCTAAAGGCGACGTGTACTTTTCACGTCATGGACGCGCCCGCCAT
TTTGATTGGTGGATTACAACTTCCGGTGTCTGTGCCCTTCATTTGAAATAAGTCCGTTAG
GTGTGTGGCTCGATCCCGTCTCGTTAAAGGCCCGTGTTCACAATGTGGCACAAAAGTTAA
AACTGGAGAGTAAAGGAGGTTTGCGGCAAAGGGCTGCTCCAGCATCGGCGGTAAGCAAAA
ACAGAAAATGTTCCACTGCTGAATAAGACTTCGATGAGCCAGTTTGTGAAGTGCGACTAG
CCCAAAATAATGTGCGGTCCGCTCACTTATTGTTAGCATAACCGCGATTGTTTAACGTTT
TGCTAACGTGATGGCTGTTAAGGTGTTTTTTAACTTCTTTTTAAGGTATCAGAATGGCCC
AGCGTGTAGCGCTATCAGAGGGAGGAAACAAAAAACACAGCAGAGTTCGGGTTGCTGTGC
GTTTACGTCCATTTTTAGCGCAGCCGGATGAGAGAGACGACGGGCCCTGCGTGCGAGGTT
TGGACTCCCAGAACCTGGAGATAATTAACTGGAGGAACGCTACAGAATCCGTCAAGTACC
AGTAAGTGGGCATGATTCTAGTCCACCCCCTTAATAAAATGTATGCATCTGTCCAAAATT
TTGTTGGTTTGTTCTCATTTCAGCTTTGATGCGTTTTATGGTGAGAAAACGACTCAACAA
GAGGTTTTCCTCTCATCAGTGAAGCCCATTTTACCCCATGTACTCAATGGACAAAACGCC
AGTGTTTTTGCATATGGACCGACAGGAGCTGGTGTGTATATGCATTATATCTGACTATTA
CTTTGGGGAACAACATGCCAAACTTTGAAATACCCACATATTATACAATAAATGCTTGCA
AGGCATATATTGTAATAAGTTGCTTTGCTTGCTTTTGCAGGTAAGACCCACACCATGTTG
GGCAGTTCAGAGCAGCTGGGTGTGATCCCCAGAGCTGTTCGAGAGGTTTTCAATCTGGTC
AATGCCAAGGATGCCAACGAGGGATGGGACTACAAAATTGGCATGTCATATTTGGAAATT
TACAATGAAAAGGTATGTTACCTTTGCCTGGACTGTGTAGTACAAGTCTGTTTTTGATGC
TTAGAGTTGCCGAACTATAGTAAAACGGATAACTGCGCCGCCTGGTTACATTCCTAAAAG
CAAACAGTAAAGCATCTAGTCAGTCAGAAAAGTACTTGTTTAGAGCTCTCAATTATTAAT
TATTTCTTTTCTCAGGTGCTCGATCTTCTCTCACCAAATTCCCAGGATTTGCCAATCCGA
GAGGACAAAGACAAGAATATCTTCATCCCTGGCCTCACTCACATAACCATCTCCTCCTTC
TCGGATTTTGACAGCCATTTTGTCCCTGCCAGCCTTAATCGCACAACAGCATCGACCAAA
CTGAATCAGCGCTCCAGCCGCAGCCACGCTGTCCTCCTCATCAAGGTTTGGTTCTTGAAT
GAGTGTGGCAACAGTTTATCTTATAACTAATCCCACTGTGTCTGTTTATTTGGGATTGCC
TGTGCATGGGTCGACATTTAAACAGCATCTTAAACGGATTGTGGCCTTTGAGCAGTAGGC
CAGAATTTGGTAGCTGGTGCTGATATTAACTCTCTCTTGCAACTCTCCCGCTGGCATTTT
CTAGGCTTTCTGGGACTTTTCTGAGAGAGAAACAAACCGATGTTTGCACTCGTTAATCAT
TTCCTGTTTTGTCTCCCCACCCACCCCCCACCTTTTCTGCTCATTGTAGCATTGGTATGT
CGCCATTCATTCTCTAATCTTCTGCTTCCATCAGGTTGTGCGAACTTGGCGTGCTCTGCA
TCATAGACAACAGACAGGCAAGCTTTATTTAATAGACCTGGCAGGCTCTGAGGACAACCG
CCGGACCGGTAACCAGGGCATCCGTTTAAAAGAAAGCGGCGCCATCAACTTGTCTCTCTT
CACTCTCAGCAAAGTTGTGGACTCCCTAAATTCTGGAACTGCCATCCGTGTACCCTACAG
AGACAGTAAACTGACACGGCTGTTACAGGACTCTCTGGGTGGCTCGGCACACTCCGTCAT
GATCGCCAATATTGCACCAGAATACAAATACTATTTTGATACCTTCAGTGCTCTCAACTT
TGCTGCCAAATCCAAACTCATCGTGAACAAGCCCTTCACTCGTGAAACTGTAGCGCCGCC
TGTACTGACAGGTGAGTGACACACATGCTCTTGTTTACAGTGGTAACAAAGACAAAACCT
AGGAGAGCCAGGGAGAGGAACTCAAAATGACCAAGTGTACTTTGCAGTAGGGTTGCAGCT
GTAGAATGTTTTAGTAATTGGATATTCTACTGAAAATCTCTTCCATTAATCGAGTAATTC
TATTAAACGTGTTTTTGCTTAGTTAAAGAGCAATTATAAATATACAAGAGAATTTCATCG
CTACTTTCCCTCAACGTTTCCATCTTTCTCCTCCAACCAAACATTTCCGCCTCCTCCGTT
GTGGCATTGTGCCGCATTAATAGTATGATAGCCCATGTGAAATACTGTGCTTTGAGCTTT
ACTTTTAAACCAGTTTTTACTCCAGGTGGATAAAATTCCTCGATTATTTATTTGTAATCA
AGGTACTCGAATTACACAAGTAATCCTTTTATCCCTACATTGCAGGCAGAGGTCAACACA
AATCTGTTAAAGGATTAAAAAAAACAAAGAGGTACCCTTGAGCAAGGTACAGACTATCTG
AATGCTCAGGAAGGGCCCTGCGATGAGCTGGCCACTCATCCAGGGGTGAACCCTGCCTCT
GCCCATATGCAGCTGGGATAGGGTCCAGCACCCTCCCCGTGACCCTGAAAGGGAACAACA
GTAAAAATTGAATTGAGTTCTCATGTCTTCATTACACTCGAGTAGACTAAACCTTAGCTG
GACTAAACCAGGATGGAAGCATCAAGGAGCACCTGGTTACAGATCGATGTCCACTAGCTC
TGGATTTGGAGAAAATGTCAGTTTTCTAATGCGTTTTTGTGATCATTGTGTTTCTGCTGC
TGTGTGAGTGAACACCTACAGGCCTGTCTGATGCTGAACCGTCTCCATTTATATACCTTT
GATCAAGAGAACCCCACAAATGGTGGTGCATGTGTGCAGTGATTACTGAGCTGTTAATTT
CTCCTCTGCCTTTCCAGTGAAGCGAGCCAGAGAAACCCATGAGGCTCAGGAATCTGGCAC
TGAGCCGCAGAAGAAACGACAGAAAGAGGAGAGAAAAACTGAGCAAGATGTTCCCTCATC
CTCCACAAGCGTTCAAAGGTAAAACCCACTTATCGATCCCTGTATTGTCCCATGTACACG
ACCAGCACTACAGCATCACGTTTGATCCAAATAAATTGCGAAACAACGGTTAAAAAAATT
AAGGCAGTGTTTCTGTGCTAAAAGTGGAGTAGAGCCCTGACAGCCTGCTCGTTTTTATAT
TCCCATCAGTCTGCGCCATTTAGGCCTACTTCTACCTAATTTAATATTTATAATTTTAAT
ATGAAGCAGTCACTGTTTGGGACATGGCCCGAGGTAGTCCTCATCTGGACAGGAAGACGG
CATGGTTTGTGGAGTAGAAATGCAGCTCGCTGTTGCATTTGTTAGCTAGATAATACAATA
AGTGGCAATGCTGAACGATCTTATGGTGCGTGCCTTTAAATACGAGGCTGCCACTAGCTA
CAGATGTTCTGTCTACAAAGATATGAGAGACAGAAGTACCTACTACCTTACACTCCTGGA
CTACCTGCTACAAGTGCTGCTACTGACTCAGTGAATTATTTTTTACAATTGAACCCTTAT
TTAATTAGGAAGTGCCACTGACACTCCAGGTCCTTGATCATCCTGCCAGACATCGTCTTC
ATGGCAGTTTAAGCTTGATTTGGTTTTCTTTCAGCCTGTCGGAGTCATCTGTGATGGACA
GACTAATTGTGCTGGAGAAGCTGATGATGAGCTGTCAGGACAAAGACAGGCTGGGCATGC
TGAAAGATGTGGCCCAGTCTCGCAAGGAAATTCAGGTATCACTGCGCCTATGCACCAGGA
ATGTATCAGCATTCCCAGGAAAAATGTGCAGCAGCTGAGGTGAAATCTGACATTTGTATT
TTGATAGGAGCTCAAAGAGAAGCAGAAGGAGTTGGAGATCAAGGCCATGCTGTTCAGTCG
ACTGGCTGGAGAAAAGGCCGGCACCAAACCGGTCTTCAAAAACACTGTGGCTCCTCTGCA
GAGGAAACAGCCAAGTGCAACAAAACCCAGCAGACAGCAGGCGGTGGTCCAACCCCTACA
AGGTCAGCAGAAGCCGGGCTTTTTCACTAGAAACCATGGCACCGGACAACGGAACCGGCA
GAAGTGTCGAGTTCTGTGTAACAAAAGATTTTAGTACCACAAAGGCCTGGCTTTACTCAT
ATTCATTAAAAAAAATTATACTCAGGGTTTTTTTTATTATTAAGAACAGAAATCTCAATC
TACGGCCTCCAGCAGCAGCACAAACACTGCTAGAAAGACGGCCAAACTTTAAATACAGAA
TATTTCCACCAAACACCACCTGATTTTACCAGTTAATCACCGGATCGTGGGAACCAAGGC
CCGAAAACTCACCTTAATTGTGATCAAACCTCTCTTAAAGCAACAGTCTCATGATGTGAG
ACCTCAAAGTATGAGCCAAACAAGTCGTGAATGACCACGGAGGGGGAAAAGTATTTACAA
TAAAAATTGACACCGTTTGGGTGTGAAACTGTGTAGGCTTCAGTGTTTATCTGTGACGGT
TGTTCTGAGAGCCTTCTTCTGCCAGAGTGATTAATATTGTGTGTGTGTGTGTGTGATATC
ATGTCTCAGTGTTGGAGCTCCAGCCTCTGCAGCAACTCGCGGTGAAAGTCAAGAAACAAT
CGGTCTGCGTCAAGAGGAAAGACAGGAAGATTCCAGAGCAAGCTGAGGTCAGCATCCACC
TCAGGTTTAACATGTACAAGCTAACAATCCTTCAGCTGTCGCCTTATTTTCCTAATCGAC
CCACATTTCGAGGTCTAAATTCACCCGTTTTGTATTGTTTCATTTGACTGTTTTCCAAAT
TCCAATTGTAATGGAAGTTGGTTTTGTCTCAGCCGCCTGATGGTAAGGAGAACACGATGC
AGACCGAGTGGGAGTCTCAGCTGGACACGTCAGTCCTGGAGCAGTCCAGAGAGAAAATCC
TGCAGGTCCTGAACACGGGCTCCCTCAAAGAGCTGAAGGGGCTGCAGCAGATTGGGGACA
AGAAGGCAAAGCTGATCCTCGGCTGGAGGGAGATCAATGGTCGTTTCACAAAGGTGGGCG
AAGAAAAGTCCCTCTGTAAAGCAGCCCGTCTTCAGCGGAGATCATCAACTCACTCTTGAG
CTGTTTTACAGGTGGAAGATCTGGTGAAAGTGGAGGGTATGACAGAAAAGAGGTTTTCTT
CCTTTATGAAGGTGAGTAGATTTTCAAGGATTAGACGAATGCAGCATTACTTTTGTCAAG
GCTTTAAAATCAACCTCTGATCAGTATTGAATTACCTTTTTCTAACAATGCTATTACCGT
TATGGGTATACAGTATATCTATATCTATATATAGATTTATATAGAATAGATCCATATGAT
GAGAGGAGCTTTGTTGACGTAACTCACTTTGTTTTTCAGGCGAACATCCTCAGTGCCATG
GGAAAGTGACTTGTATTTTTTTACATTTATATATTTTTTGTGTGGCTGTGCATCATGGCT
CGTGTATATAATCTCAGCAGTTTGTGTCACGGATGTTTTAGGCTTGAATATTTTTGTAGT
TACTCTTGTGTTCCAGCTGATGGCGCATTCCTGCTTTTTAATAAACTCTCAAGACTCCGA
CTGTCTCTTTATGTCTGAATAAACGTGGCGGAAACGGCCCCGACACACAAACGTGGCATC
TTTTTGTTCTGCACACCAGTGATGTTGCAGCTTCATCCTTCCGCATCACATCTGCTGGAT
TTCTCTTTTCCTTTCTGTCCTTCACACACGCACACTCTCCTCCCTCACCCGCCCTGCTTT
TCAGGAGACTCCCCATCCCTCCCTCACACTGCGCTACAAACATCCCCGTCCTTCCTCAAC
CTCCGCACGGGTCCCTGCAAACCGAGCGAGGCGTGTTTGAACCGGATCTGCCGGCTGGAG
ATGCTGGTTCGGTTCTGACGCGGATCTTTTTTGCAGCAGAGAATCAAACTCCCACGATGC
CAAATCCAGGGACGCTCCGGCTGGATTAAAAAGGTCAGTCTCCTGCATCCGCGGCTCCAC
TTCTTCTCTGGCTCGGAACCGTCTCATCAGCCTCCGACCATAGTTTCCTGTTAAATGCAA
ACATCTAAGGACGCGTTCCGTCCATAAGCCCGTCAGCGGGGCTGTTCACACCCAATGAAT
CTGCGGGAGCGGCTCATCATTTAGCTGCTCCCCTCATCGATCAGCGCTGTTCTTCCTTTG
TCCTCATCCCTTTCTCTGCTCATTTCAGCGAGCGCGTGTGTTTGTGCACATGACTGAATG
CGCCTATGTGCACACCTGCATCCATGGCTGCTCCACCTGCCTTTGGGACTCGCTTTTTGT
GTTATCTGATCCAGCGGGTTTATTATGAGCTCTGCGGCCTTATTTACCCTGTTTCCGTGT
TTGCTTTTGGGCTGCGTGAGGAACACCGATTTATTAAAGTGACTGTAAAACAGACAGGAA
AAAAGAATTAAAAAGCGAATTAAATGACATGAGAGAAGCGCCCGTCACTATGTGATAGCT
ATTGTTTTAAAATGGAATGCACGTGTTTATTTAGAGATTTGTGCATTCATCTCATAAATA
ATAATCTGTCACAAAAATGATGTAGTTTAGGTACTCAATGTGAAGTTTACCATTTAATCT
GAATATGTCCAGTAAATCCTGCATGTTTCTGGAATGTTGGCTCTGTGGCAGCCAGTTCAG
GCAGAGTTTATGTGCTTGTGTGGCTGATGAAGGTGCTAGACTATAAAATCCTATAGAACA
GAGGATTTACTTGTTTCTGCAGACTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1129, 1304..1500, 1583..1710, 1840..1991, 2175..2384, 2734..3130, 4097..4217, 4807..4954, 5047..5221, 5769..5866, 6047..6232, 6311..6370, 6579..6604, 6925..6946
1070..1129, 1304..1500, 1583..1710, 1840..1991, 2175..2384, 2734..3130, 4097..4217, 4807..4954, 5047..5221, 5769..5866, 6047..6232, 6311..6370, 6579..6604, 6925..6946
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved