Takifugu_rubripes Locus RPL4
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes RPL4
Takifugu_rubripes
RPL4
scaffold_2
SNORD16, SNORD16, SNORD18, SNORD18
2043..2142, 2419..2518, 3221..3291, 3485..3552
5093
AAATTATTACTCACAGCTTTTTCACAAATGAGTACTGGCTGATTGGCACAGTACATATT
TATCACAGGCAATTGGTCACCCTTCATCTTTAATATTTGCATGTCCTCCTGAAACCCAGA
GAGAGTTCAGTAAATTATACTGTAGCACAGATAAGATGACAGAGACCATATTGGCAATTT
ATTTTAAATAAAAAGTACCTCAAGTATGTTACAAGGATTGCTGCCTCCCTCTTCATCTTG
TAAAGACCTTTTGTACAACGCAATTGACAACGATAATTAATAACCTCTTCAACGTAAACT
GTTAATGGTTACTAAACTGAACAAGTACATAATCTTAAACGGACAATGCATAGAGTATTT
TGAAGTTAGCCAAGAAGGCTAAATTGTATGGGGTTCAGAAAAACAACTACAACAAACTCA
CCGTAGAATATTATAAAACGTCTTAGCCCTTGATATCATCTTCGAACCCATTTGAAAATG
TGCCACGATAAATTCCGTAAATAGGAGAGATTTTGTAGGGGGGAAAACTGAAGTTTGACG
CAAATTTCTAATTTTTGAGCTGCTGTTATTTGACAGTCGCGCGCTCTGCTGCTGACGTCA
TAAGGTCGTAGTTCATCATGTTTTCGTAGTAGCTTAACGCGCCATGTAAGTAACTATAAA
CTTTTTATATATGCATACCCCCATAAAGAATGGCTATAACACAACTGAATATATGTCACA
TGTTATTGAAAATACAATTTATAGAAAATGGGTTTTTACTAAAAACCATCATCCGCCAAC
ATGGCGTCAAGAAATAGTTCCATTTACAACATACTTCTTTTCATATTTAACAGTCGTAAA
ATAATATTAAAACGCACATTATTATTTCTTGGTATGGTGTATATTTAGTAATGTGTGTTC
CTTTACAGTATGCAAAATAAATTAGGGAAAGACTGTGCAGCCGGATGTAGTAGTCCTTAG
GCGGAGGCATAAACCATTCGGTGTGCTTTGCTAACTTCCTTTTTACTGTGGCCGCCCTAG
CGAGTGGAGCGTGGTCCCGGCGAGCCGAAACCTAATTACCGAAAATGGTAAAGATCTTTG
CTAATTTTATACACAACCTACATTGGCATACATTAAGCAATGTTTTTTATTCACCCTTTA
CAAATATGCAAAGGTTTGTTATCTTTAGGGCGCTTTAGAATAGGTTAGGGGACAAGAGTT
GGAAATGCCCCGGCTAGCGAAGCTAACACGAGGAGCCATTTTGAAAGAAACTGCTCAGTT
CAGTTACACGTGTCCTCAGATTCAGTGCTAGATTGTGAAAAGTGATGTCCGATTATATCA
TCTTTTACACTGACTGTATGTATTGTAACATACTGGTGTAACTGATGTTGCCCTCGCAGT
CTTATTTGAGTGTAACCTGACGATCGTCTTACTAATGTGCGTGTTAGCCAAGTCAAGCTA
AGGCCAGCAACTGCAGAGTAATGAGAAGTGTCTGATGTCGCGTTAAACGTCAGAACTTAA
AAGATATCATCGATTGGAAACGACTTTTAAATTGACTTTGTTTAAACGTGATTGTAATTG
AGTTCTATTTGGTTTTTAGGCCTGTGCCCGACCCCTGATCTCGGTTTACTCCGAGAAAGG
AGAATCTACAGGCAAAAATGTTGTCATGCCAGCTGTATTCAAGGCTCCAATTCGCCCTGA
TGTTGTGAATTTTGTTCACACCAACATGCGCAAGAACAACCGTCAGCCTTATGCAGTCAG
TGAACTGGCAGGTGAGTCCATTCCATTAAGACCTTCCTAATTTGTAAGATTCCAAGTGGC
TCATGTTCTTATTTTTAAATGGGTTATGAAATTAATGTTGGTGTATATTTGTTTCAGGTC
ACCAGACCAGTGCAGAGTCTTGGGGTACAGGAAGAGCTGTTGCTCGTATCCCTCGTGTTA
GAGGTGGTGGTACTCATCGCTCTGGCCAGGGTGCTTTTGGAAATGTATCCTTTCAGCCCT
AAACAAGATCTTAATTTCAGTTACTTGAACTTATATGAAAGGTGGGTCAATGCAGCATAT
ACTTGCACTGATGGTGTAATTTGCGTCTGACTCTGTGACCAGTGACAGTTGCCTGCTGTC
AATATGCTGGCGCATATGGCTGACGAGCAACAGTGTCTGAGCAGGTACGTATATTTCAGG
ACCTACAGTCATAGGCTGGTCAGACTTCCTTGACTTTATTTTAGATGTGTCGTGGAGGTC
GCATGTTTGCCCCAACCAAAACCTGGCGCCGCTGGCACCGCAGGATCAACACAACCCAGA
AGCGCTATGCCATCTGCTCTGCTGTGGCTGCCTCTGCCATTCCTGCTCTTGTGATGTCCA
AGGGTAAGCTCAAAATCAGTTTGAAACTTTAGGACGTGTATAACGACAGGTTTTCATAGA
AAGCCTTTTACAACGTTGTTGCCATGATGGTGTAATTTGCGTCTGATCCTGTGAACAGTG
ACAGTTGCCTGCTGTCTATATGCTGTCATGGGTACTTGATGTATATTAAAGTCTGAGCAA
GCACCGTTGTTCCTCTTAAAAAGTTTAAAGGTGTGCTTGGTTGACCTCTTGCTGTGATAC
ATTTGTTTTAGGGCACCGCATTGAAGAAATCCCAGAGGTCCCACTGGTGGTTGAAGACAA
AGTTGAGGGCTACAAGAAGACCAAGGAGGCTGTGCTGCTGCTGAAAAAGCTCAAAGCCTG
GAATGACATTAAGAAGGTATGGTGGGTATTTTTATGATTGCCTTTAATGAACTTAAAAGA
AACATGACAAGTATATTAAAATGAGCTCTGGATTTAGGTCTACGCCTCTCAGCGCATGCG
TGCTGGTAAGGGTAAAATGAGGAATCGCAGACGCATTCAACGCAGAGGACCGTGCATCGT
CTACAACCAAGACGCCGGAGTCACCAAAGCCTTCAGAAATATCCCAGGTGATTTCATCTG
CTCGTTTGTCGAATATTCTTCAGTGAGTGGATAGCAACTGACTTAAGATTTTAACCTCTT
TGTTTTGCTCTGTTTTTGAAGGCATCACTCTACAGAACGTGAACAAAATGAATCTGCTGA
GGCTTGCTCCTGGTGGCCATGTTGGACGCTTCTGCATCTGGACAGAGAGTGCTTTCCGTA
AGCTGGACGAGCTTTACGGCACCTGGCGTAAACCTTCCACCCAGAAGGTTGACTACAAGT
AAGTGTTTAGATTTAACTGCAACAAAAGCGTAACTGTTCCGTTTCAGTGATGAGCTTCTA
CTTCAGGTCCGTGTTTTTGAAACAATGTGATATTTATCGAAGTTCTGAGTTTAAAGGTCA
AACAAACACAAGTGTGTAACAGTAGAGTTCACATGAACTTAATTCTTGATGGCTTTTTTT
CCAGCCTTCCCATGCACAAGATGACCAACACTGACCTGAGCAGGATCCTGAAGAGCGAAG
AGATCCAGAAAGCACTTCGTCCACCAAAGTAAGTATCGCTGAAGCTTTGACACGTTTCAG
CCTGTTACAAATGATGATGTTCCACTTCTGGTCCGTGTTTCTGAGTCCTGATTGTTATGG
AAGTTCTGAGCAACAGAGTTGATATAAAATGTCTACCTTGGTGTCGGTGCATGTTGATAA
GCTGGCCTGATACTATCGTTGCAGAAAGAAGATCATTCGCAGAGTACTGAAGAAGAATCC
TCTGAAGAACTTGAGGATAATGCTCAAACTGAACCCATATTCCAAGACGGCAAGACGCCA
TGCCATCCTCAAGCATAACCCTGAAGTAAGGGCAGCTTGGACTGGACATAAGACATTATT
GGCCTTGATTGCAACCTGAAAATATTTCTTCTCTCCACAGATCAAGGCTAAAATGCTGAA
ACCCAAGAAGAAGCCTAAGAAGAAGGTGGAAGCTGCTAAACCCAAGGCATAAATGCTCAA
GAGTTCAGTACTAAATAAATCATTTGACTTACATAATTGAGTCGGACGTGTTTATTACAA
TTTTTGATTGCACATGACTGGCAGTTGGGTTTGCACAGAAGGACAAAAGGTGAGTTTGAG
GCACACAGCTGAAGTTGGTCAGAATACATAGAACCAAAACTGAAAGGACCAAATCAACCG
AAGCAAAAAGTTGATGCTAAGTGAAATATTCAACAGAAAAGGCACAACACTTTCACACAA
CTCAAAATCTTGCATCTGGAGAGCAAGGGCACAAAGATCTCCTGAAGCACACAGCTAGAG
CAGCTTCTAAGGTGATTGCATCAATAGAAAACATGGCTTTCCAGGCAGGCCTGAGGCTCA
AGAACTGCAATATAAAGTTGTCACAGAGCTTTATAGCAATTGAAAACTGAAGCTATTAGA
ACTCTCCAACCACCTTCTGCTTAATACAAATCCAGTGATGACTGATGGCACAGAGTTTCG
TGAGCTCACATGGCTGTCCCATGGGTGGGCGTCCCGGGCTGATTCAGGCCGATGGTGCTG
CACAACCAGCCAGCAAAATCCACCTGCTCTGCCTCAGACCGTTTGATGAACGGATGCACC
TGACAATATAGACGTGCGTGATGTTAAAATGAGCTGAGCTAAGTGCAGGACGTGCACACT
CACCATCAGCTGCTTCAGGTCTGCTCTATCTGCTGGGTTCTTGACCAAGCTGCAAGGAAG
TACAAACGGATCACGATGTGCTGCGTTCTGCGGCCACTAGATGGCACAGTATAGTCAATA
TGTTGCTGAGAGTTCTCCCACATACCATTTATTCACAAAGTCTTGAAATTCCGCGCTAAA
TATTGCAGGCAGCTTTGGTGGAGGCTGCAAATTGAAAGACAAGTTGCAGTTTAAGTTCCT
TAAAGGCATTTCCAGGTGTGTGAAACGTAATGAGGTGGAAACCTACTTCATTGACGATGT
AATCAAGTAGCTCAAATATTGCCATGGGTGGTCTGCTGTCAGAACCATACGCTGTGTGAG
GAGAAGAACACATCATCTGAAGAATATCCACAGCCATCACAATTTATTAAGTCTACGATA
GGGAAACACCCATACACATGCCAGGTCGCCCTGGCGCCCGAGGCTTTGGGGACGACTCGG
TGAAGGCCGCTTCCCCCTCCACTGGGAATCCAAAAATCTGCTCCAGTTCCTTAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1066, 1579..1750, 1857..1963, 2204..2342, 2591..2715, 2797..2926, 3021..3177, 3364..3447, 3624..3744, 3820..3860, 4042..4093
1064..1066, 1579..1750, 1857..1963, 2204..2342, 2591..2715, 2797..2926, 3021..3177, 3364..3447, 3624..3744, 3820..3860, 4042..4090
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved