Takifugu_rubripes Locus Mono:4:SNORD52
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes Mono:4:SNORD52
Takifugu_rubripes
Mono:4:SNORD52
scaffold_291
SNORD52
1001..1069
2069
AAAGCCTCTTCCGCATTCCATGCAAGTCTTTTTACCTAAATATCGCATATAGTTGGAGA
CTATTATGTTGACATATTGACCAGTTGAATTAATCTTCAGTATCCCGCAGCAAAAACGAC
GGATCATTTTAAAAAGGCAGTATCGTGGACAGCTCACACGGCTACTGGAGGACCTCGGTA
TATAAACGTCCGCCGCGCGTTTCCCCAGCCTCTCCGTTGCGGCCGTCGTTTCAGACTGTT
GTGAGGATGTGATCAGCTCGTTTGGGCCAAATTAATGCTTAAAATGGCACGACGGAAGGT
AAGTCGTCTATATTTGACTGGTTTTAAGACTTTCTGCGTTTTTCCAGACTTCTTTTAAAG
GCCCGATACACACGTTATTACAGTCACACGTGGTGTAGTGGTGACACAAACTTAACAATT
CTAACTTGGAAGTATTTATCGTTCCATTTAAGCTTTCACTCGTAGTTAAATATCGAAATA
CTGCAAATTAGGGTTGTCGGATGTAAGCAAACGTTTAAGTATTTGGTATCTATATTCGAT
GCTTCAGTTTTAATTTCAATTGTGCAAAAACGATTACGTTTCAATCTGTAAACTACAGAA
ATGTGGATTTAGTAACATGCAGGAATCAACTAGGAACCGTTACAACTTAGCCGGTTTTAA
CCTGAAGCACTGTGTTGTGTTGCAGGCTGTTCCGAGATGACTGGATGACCCGGTCCACTA
GCTGTGGTGCCTTCATGGCCGCTGAGATGGCCTGATGTGAGTATCACCATGCTGAGTGCT
GACCATGTTACTGTGCTGCTATGATGAAGCATTAGACTAGAGTCTCTGATCCTCATGAAG
TCCTTTCACAGTGCACTGAGCAAGCTTCTTTCATACTCTTTACCAGCCAAATACCGGAAG
TCTCTAAACCACAGCTTTCTGTTGACAGGTTTCACTCGCCGGGTCGCCTGCCGGAGCTGC
TCCTGGTGAGTCTGGATTAGGGCTGTGCTTGGGCCGACATGTGGAATGATGATTTTGCAG
ACTAGAGTCTCTGAAAATCCTGAAGTAGCTTTCTTTTATTGCACTGACCACATGTGATTC
CCACCAGACCTCACTGGCTTTTTAGTCTTAATGAGTTTAAAGTAAACTGGAATAAATAAA
TCTTCAGTAAATGGCTTTAAAATGCCCTCATTGGTTGGCAGTGGTTGCAATAAAATGAGC
CCTGTCAAATATCTGGCTGCTCATGTTGCTGTCTTGTTTTCAGGTTGTTGGCCTGTGACT
GGAGCTGCAGCTCTTCTGTAAGTCCCATTTCTAATCTACAAAGAACATATGTAGTGATCA
CACACCAGTTGGGTCGATGATGATTCAAATATTCGGTTCGACTGAACATAGTGAAGTTTA
CTCGCAGCGCACTGAGACCCTCAGACTGTCGGGCAGATTAGTGTGCCGGGCTGGTGACAA
AAACACTGACGTTTCTCTCTCATCAGGGTGGATCACAGGCTCAGGGTAGAAGAACTGGGA
GGAAATGCTGGAGCAGGTCAGTTCTGCAGTCATTTTTGGCATCTGCTAATGTTTTCATGA
AGAGGCAGAAGCACCCTGAGAGCACGCAGGGCTAATGGCCAGATGTGCCAAATGGTTGGC
ATCTGTTGCTGGTCAGTTTAAGTGGATGGTCACATGACAAGGCAACAGATTATTGCTAAT
AGACAATGTTACGTCCAGTTTTAACATCCTTTTCATTGTAACTGTAGAAGTTCTGTTTTC
CCTTTTAGGTGGTGAAACTCTGGATGGTGATCTGGTGGACGCAGGATTTCAATTCAAATG
GATCAACTCACACCGATCCCCTGTTGAAAAGCTCATGAATGATTTTTATGGCTTGTGACA
GATGTCTGAAATCTTTATTAAAGTGTGTCTGTTCAAATGTGTGTGCTGCTTTTCTGCCAC
TTAAAGAATTAAGTTATAAACGGTAGACTGCTGTAAAAAAACAAAAAACCAGGTGTAGCC
TGTGAATCAGGACGCTCGGTGGGGAATGTGCTGCAGCGGCCAATGACTAAAATAACTCCT
CAACCTCCAAACTGGGAAGTTTTGTTGGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved