Takifugu_rubripes Locus Mono:0:SNORD67
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes Mono:0:SNORD67
Takifugu_rubripes
Mono:0:SNORD67
scaffold_1
SNORD67
1001..1114
2114
TGTTGTTTTACTCGCTGTCGTCGCTAGAGGGCAGTCTCCTTCAGTAGACTGAGCCGGAA
CATATGGAGAGACAATTGACGCACAATGCCGAAAAATGGTTCGAAACCCGTAGTGAATGG
TCTAAATGTTAACAGGTCTACAATGGACAGAGGGAAGTTTCGTTTCTCCGTGATTTGACC
CGACCATCAAGAAAACAGGCACATGAATGTTCACTGATTAAATAACTGAGTAATAATCAT
TAAAAAAAATTTAATTGCATTTGAGGAAAGCAACTCAGAGCTGTTGGTTCAGTTTGTGTA
GCTGACAGCTGTACATGTGGGCATTAGTTAACTTACCTCTAGTGGTTAAACCCAAAACAA
ACCGACAAACGAACGTTCAGGCTGCCTGGACCACTTTAACCCAGTAGGTGGCGGTATCAC
ACAGTTCACAGGCTGCAGGCCACCAACCTATCAAAAGAAGAAGAAGGAGGAGCCCGTTTG
GACCAATCCGAGAGTGGCGTTCATTGATTGGCTGGTTTAAAAAAAAAACAAAACTTAAGC
TCCAGAACATGAGGCAACTATGCATTCCACGACGAACAATCAATATGAACAGGACGAACT
TGAAGAAAACCAAGCACGGGTCACAGGTATAAAAGCGAGTTTGTATTGTTTCTACCTCTT
AATATTGGATTGTTACATTTAGAACGAATAGTGTGCCTTAATTGCTAACCTACAGCAGCT
CTTACGAGTTAGCATAGCTAACAATGACCGCTACCTTCGCTAGATAAGCTTAGCCTTTAA
AATGTTCCAGGATAGGATAGGATAGCGGTTGCCCATGAATAAATTTAACTTGTTATTTTT
GTATTCTACGTTTCAGACTTTCGGCCCAATTCTGGTCGAGCCCTCAGATGGCGGTGAGAA
TAGACCGGGTTAAACTGACCTCATTTACCAGTAAACACAAGGTAAAATCTAACTAGTTTG
GTTCTTCCTTCCACCACTATATTAATACAATTCATGGTGGGTTTGAGAGTGATGAGTTGC
ACGAATCAGTTGGGGTGTTTGATGCAGTGGCAACAACACTCCAATCCGATCCAACCTGAG
GACACGCACAGTGCACAGGGGCCATCTGACTCAACCTGACACCTTTCCACATTCCCAAAT
GTGCTTTCAACTAATGAAACGGCAGATTATTGCTAAAGGAGAAGTCGTGTTACACGTGGT
CCTTTGTTTGAAGCAAGATTTTTAGGATCGTCTTGGTTTTCCTACATAAACATTCATCCA
ATTGTTGATTCATGGAAAGTGTTACAAAGCACTTTGTTTTGTAAGACTATTTACGCATGG
TCTTACTTTATTTCTTTCAGAGTACAGCAGATGTGTTTGTGGAAATCCCCTCCACTCGTC
ATGCAGGACTGACTGGGCAGTGTGCACTGAGGTTTGTTTCTGCTCATTTCTAGAGTTAAA
TCCACAAAAAACAAAATCACATTATTTACTTGGTGTGCTTTCAGCAGCCGGCTGTGATCT
GATCCCGTTCCAACAGGAGATGGAAGAAAACTGCAACGGCACCGATGAGACGGAAAGCAG
AAGCTACAGATCCAATGTGTCACTCCTTTGTCTTTGTTAGTGTTCTCACATTTTACCTGA
GATTCAATAAACAGAGGCCTGGCACCAACTCTGTCAAAACAACACTTAAATGTTACCATA
AATGCCGCATACACTGTGCTGAGAGATACTATTAATAAAAATCTGGGCTTTTTTGGAAGT
CACACATCTGTTTCAAGTGAATATTTATATATACCATCACACAAATGCATGTACACACAT
GGGTCAATCTAAAATATACTGGGTTTTAAAATTTGTGCATTGGATGTTTTTTTTTTTGTT
CTAAGGTATAGTTATAATTCTAAGTCTGGGGTTTTTTTTATGGGTTTTTACACAGATCAT
CAGATATTTATTAACATGTTAAATGACGTAAAATGTATTAGACAAAACTAAAGTATTCTG
AGTTTCTGCATCTTGTTTGATTCCAATTTTGACCGCGAGGTGGCAGAAAAACACCGCTAG
AATATATCTTGCAAAAAAACTCAGGCCTCCGCGTCCTGCAGATAGTACACGTGATACAAT
TATACACCAAATTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved