Takifugu_rubripes Locus Poly:1:snosnR60_Z15
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes Poly:1:snosnR60_Z15
Takifugu_rubripes
Poly:1:snosnR60_Z15
scaffold_122
SNORD74, SNORD75
1001..1082, 1429..1494
3554
AGTATGGTCAAGCAGCTCTCTTCTAGTGTGTTTAAATGAATCTGATGATAATCGGTAAA
GGCGTTTCACAACACAAGGTAAAGTAATCTGCTCTTTTAAATCTTACTCAATGTCTTAAA
GTAAGAAAATTGAAATTCAGATGCTGATTTTGGTATTACTTTAATATGCTCTTTCATACA
TCCTTGTACAATATGTTAAGTTGTGGCCTTTGCATACATTTCATTACCATAAAAGCTGAT
CATCCTGTTTTTATTTAATTTTGATCATAATGATTGTATTGTGTTCCTATTGATGCATAT
TAAATTGCCATGAATTTCCTCCTGTGAGGTTTGGTAATTATAGGGGAGACAGTTAAGCTT
GTAATGGATCCATCGTCATGCCTCATGCATTAGGGAGGGAATATTTAGAAAATAAGATGT
TTTGCATTTTACTGCCGAGCTCAAAGTGTTTAATGAAAACTAGGACAAAGGACAAGTTTC
TGAATGACAAATTTGCATTAGAAATAATGCAAAAATCGTTTTATACCACTGAACACACGT
CCATATTGCAAACAGATTTTTTTGTTTGTTTATTTAGTTTCCTGTTATGTGCGTGAAGTC
TCCAAGTGTAGTTTTCCACAAAGCCGGAAGTGCGTCACCTCGCGGGGGCAGTCCTCCGTC
TTTTCCCATCAGCCTTTGCGAGTCCGGTATAAAAGCGCACTGCACCCTCAGTCAGTCCTC
ACTCTGCTGGTCCTCACGGTTAGTATGTTGTATTGTCTCTGTTTCAGTTTTATTCAGAGG
CCTTTCTTTTTAAACTGAAATGTAATTAAGATAGTTTGTCGTTTTAGCGGCAATCTGGCC
TGTTTTATTGAAAGCGGCATGTTTTTTGACCAGCAAGAACTGTTTTGGACCAAAGGCCAC
CACGTGTTAATGCAGGCATGCTAATTAGCGCTAGTGCTAAACCTGCTGTACTAAACTGTA
CTTTTGAACATTTAATATTATTATTCGCAAGAAGACGCTCTCCCATGCGCACATGATGAA
ATAAGTGTTGGTAGGGACATCTGAGTTAAGGTGAAGAAATGCCAACTCTTCTGACTTCAT
GGGACGGCAACTAGTTTCTTGTCATGTTAGCTTTGTGCAAGCTGTAGTGATGTGAATTAT
TGGGAGAGCTGATCGTTCTTTGCGTGCTTCTAGCAAGAAGTTTTTGGGAAGAAAATACCG
ATACATTTCGTTGGCATGCTCGATCGCTACAAAATGGAGTCTGTCGTGAGGTGAGGAATA
ATAAAAATTCACTTGCACCATTCAGTTAAGGGGCATTTCTGTAACCGGGAAAGCTAGTAG
CTTCATGTGAGTTTGACAATTCGATCTTTTTAGGTTCACACCAGGAAGATCTCTGGGCCT
GAGCCGCGACACTTGTGAGTCACGTGACTTTAATCACTTCTAATCCAGAAGTCTGTGATG
ATAGAGATAAGAGTAGTGGACAGAAGAGATTTCTGAACAAAAGTATGCTGAGACTCGTTG
AGGAACAAGATCACCAATTTTTGCATGTGCCCAGTATGTTTACGCATATAAATGTTTACA
GGTGTCTTCCAAATGGAGAATGGTGTCGATGGTTAAGCAGCAGACTAACAAGGTGAGATG
GAGTTCCCATCAGAACAGTTCTGCTGGATTGACGATGCTTCTCCGTGTGCTTGTGATATG
CATATTAACTCTATATTCTAAACACTTTGGTTGCGTAAGCTTGAGGGGGGGGGAGGGGGG
GAGAAACTTAAAGGGTGTGTTGCCGTCAGTTGCACCCAGAGAAGCACCAGTCTGGTCCTG
AACATGCTCCTGTCCATGTGCTGCTGTGATGACATCATATTTGCTACTCTTGACAAAATG
AATGACGAGACATCTCCCACCTTATGGAAACTGAGCCACACAAGGTCCTGTTTTTGTAGC
AGACATGAAACTTGGGAGTTTTGACGTTTTACTCTCCTTGCAGATGCCCCCGATGAGCTT
TAAATCTGCTAAATTGAACGTGGAGTTCAGGTATTTGTCATTTTGTGTATAAATATTTTT
TCTTAAGCCAAGCTGTTAATGATGATCTTGTTTTAAAAACAATGGGAATCTCTCTGAATA
AGAGTGAAAGATGACTTTCAACTGACACAGTACAGATCAACAATGTGTTGTACTTGTTGG
AAAAGGAGCCATACTCATGTTGAATGTCTCCTTCCAGGTGTTCGGACACTCCTGCTTCAC
CTGGCGTAAGTAAAGTCTGCGATTCTGCAGCTTTTATGATGCTGGATACGGTGATGATTG
CATAGTTCAGCAGAGTTGACTGTGAAGAATATGCATGTCTTTCGCTCCTAGCTGATGTGT
CCACATCCACAAATGGACACTGGAGCAAAAATTAAAGTAGTTGTTCATATTATTTTTTTT
CATTTTCAGAAATGGGAGTGGGGAGTGCTTAAGGCATGTGAAGGTGAGTTGAAGAACTGA
TAATCAATGTTTTAATAGTCTGATGCAATGATGAGCCCATAGTTCAGCAGAGAAATCATG
AAGAATAATTCTTTCGCTCCTATCTGATGTGTCACACTTCAACTTTATGAAGGTGCCATG
TGTCATTTTGAAAGCTTGTAGTAATTCATTCTATTCCCCACAGGTGCCTGATCTCCCGGT
GTCTGTCTTCACCGCCACAATGGTGAGTATCGTGTCAGAAAAATAAAAAATTGATGTGCT
CGGATGGGATGAGTTTGAATCAGGTCGCCGATCCCGTTGAGGAAAATTAATTAATTCTGA
TCTGAGCACCATATTTACCTTCAGAAGACGCCTTACAATGGGATGTTGACGTTAACCCTC
CATTACAGGACTCTGGCTCGTGTCCCGGGTGCTCATGTCTGCATTGGTAAAGGTGAGTGT
GAACGCACATGGTGACGTTTCAGACCTAGATGGGCAGAGTTGAAGTGTAGGTTTCTGAGC
TTGAATCCGAACTCTGCGTCATCCTGGTCCGAGTGGCTGTTGCACCGACCTGTGTGATGA
CAAATGTACAGCCTGACACTTGAACGTGGAGTCGTTATTAGCTCTAACTGACCTGGTCGG
TTCAGGTGTTGGCCAGAGTCGTCATGATGGTTTTAAATGTAACGTGATTTCCTCTTCAGG
ATTCAGCGTCACTCCTGTCGGAAACGGAGCTGGTGGCCTATGAAGCTCGTCAATGTTGCA
AAGGTAAACGTCTCGATGAACTGGTCTAATTGCTATTGAATTGTGGCGTTGGGTGGAGAC
CACTCTTCCTGTGATGAACATATTCTGCCAGATGACTTCTGATTATAACTCAATACCGTT
CCATTATTTCTGAGGTTGAGTGGTCAAACCTGCTTGCAGGAAATGTGTTTGAACTTGATG
AATATCCATATCTGCTTCTTTCTAATGTGTTTCTTTATTTCAACAGATGCATCAGGACAA
CTGAAGACAAGTGCTGCTGACTTTTGCAGTTTGTCAATAAAACTCTGGAGAAAAATGTCA
TTTGTAGATTTCTTTCTTCAGCGGGGGATGGGAATGTTCAAGAATGAGTTGTCATTCAAC
ACAACCAGTACCTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved