Takifugu_rubripes Locus Poly:3:SNORD30
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes Poly:3:SNORD30
Takifugu_rubripes
Poly:3:SNORD30
scaffold_315
SNORD30, SNORD22, SNORD31, SNORD31
1001..1070, 1228..1354, 1500..1569, 1719..1786
2786
TCCATTTCAGATGTTTGATCCTGGCTAACAATAAAGGAAACTGAGCAGGTAAGAACTAA
AAGGAGTTATTAAACCAGTCCAGCAGTGGCTATTGTTGATGATATTTATATAGACAAGCA
TATGTCTGATTTTAATGATGCCACATTTTCAATCTGATGGGCCACTTAAATGTCTATACC
CACATTTAATGTGTTACTACATGACTAATGTCCTACTTTACTTACAGACTGCTCTCTGCT
TCTGTATAATCCTGATAATCAGACTGAAGAGGTGAGTGACATGAGCCTTCACTTAATTAA
ATTAATTACTGGGGTCTAAACATGATGATTCCAAATAATGACAAGCATATGCCTGATTTT
GAAGTGATGCCAACCTTGAATCTGATCCCCCCTGGTTGTAAAATGAATGGGGTTTTTATG
TGTTGAATGGGATTAAGGTGGCGTTTGTCTTCCAGGAGGGACTAAAGACGGATGCTACCT
CTGCTGTACGGGACGACGTGGAAGTCTGCAGATGTAGGTATTACGCACACTTACCAGAGG
GTTGTGACTGTTTGAAAGGATGAAATGGGGTTAAACCCATCAAACAACTGGACGGCTAAT
TGTCCCATGGCAGTTTGTCACCAAAGCCCTGATCGAACGCTTAAACTTCCACACGTGGCG
GCGTTGTAGTGGGATTTGTCTAACATCGTCTCTTTCCTGCAGTTGATCTCGGAGGGCGGA
GTCATCGGCATTGCCAGGTGAGCTCAGCCCTGCGGCCGTTCTCGGCGTGGTTCAATGATG
ATGAAACTTAGCTCACTTTGACCCGATGTGAAACGACACGAACATCTGAGCAGCTGCGCT
TCAGTCACCTCTGCTCTTCCCGAACTTCTAAATAAAACAAATCCTGCTCCAACTGAGGGT
CTGTAATCTGTCTCGCAGGTGTCTGAGGGTCCTCCCCGCGGTGCATCGAGCTAAAGGTGA
GTTCTGCCACGGGGACGTTCACAGAAATCCTCAAACCTGCTGACAATGATGAGATAATAT
TGGAATCTCGTTCGTCTGAACACCTGTTGAGAAATGGAACATCTGACATCAGTGTAGAGC
AGCGTCGGCCGTTTCAAACCAGCGAGACCGGTGCTTACACTCGTCCCCTTTATTTCAGGT
TTCTGCTGTGGGATGCTGACGGTGCTACCACAGATCGTCGCCCCGGTGAGTGGACGTGCG
CTGTGTTGGGGTGGTAGGAAAGCGGTTTCCTTGGTGATGACACCCGCACACGTCTTACGC
CTTGCGTCAACGCCAGAACCTGAAAAGGTGAACCCACTGGTGTTGCCTTGGCAGGAAGGG
GAAGACTTGTTGGGGTTACCAACAGTCTGAATGGAAACTGGTGCTCAGATCTATAATTAT
CTCTTAAGGGTTGGAATCTAACTGGTTTCTGTTTACAGCTGGGATCTGGGATCACTGAAG
ATGCCTCGCTCTGTCCCGGCTGAGGTACGTATCTTAGGTGAATCAGTTTTTACTCGTATC
CGACCAATGATGACTTAAGTTACCGCCCCAGTCTGATGATTCATGACTGATCGGTATTTT
CTGACTGAAACGGTTGCAACGCCGTGATCACCTTTATCGGATCGGGTGATTAATTTCTGA
CCTGTTGCAGGTTGGAATTGCTCGGGATCTCCTGTGCCGTGCGCCAGCCTGGGATTTTAG
AAGGTAAATGATGCCCAAGTGAGGCTTTTTGTGTGGAAAATGTCAAATGATGAGTAAGTT
ACCGCCCCAGTCTGATGATTCATGACTGATCGGTATTCTCTGAATTAAAATTCCCTAATA
ATAGACAGGCGTGGCAACAAAATGTATCCGCTCGGTTTTATGTGCATTATTAACGCACTT
CTTTGGTTACAGGTTTGAGACTGAAGGTGGCGCCATTTCAACGCTCAAGACCTGTTTGCT
TGATGACTGAATGAAACTATTGTATTTTCCTCAATTATTTGAACAATAAAGTGAAGTTAA
AGAAACTCTTGTCCTGCTGGAATTTGAGCCAAGAGTGAGGTTGCAAAACATGAGCGACCC
TGACGTGCGATCCAAACCCAGTTCTGGAGGGCAGACACCAGCAGGGTTTTCTATCCTACT
GGTTCAACACTTCCCCACCGGGCTCCCATTTCCTTCCCTGGTAGAGGACAAAGTCTGGAT
TTCAACAGCCGTCTGCTTAGAGTATTAAGTTGCCAGTGAAAGCTTTACATTGGCCAAAGT
TTGTTCTCGTAACATTCTCTCACATAATTGGACTAATGATCCTTCAGGCACAAAGTTGCG
TGTTTAACAGCTTAAATAAGTGAACTGATCCCAAGAATCACCCTTTACTGACAAGTCACA
CACTACATTCTGCAAACCATAAATAGTTTTCAGTTCATTAGAGTTCTGGGTCCAACTGGA
ACTGGGCCGTCACTCGGCAGTGAAGATCCTCGCAGCGATGTCGTCCAGTAACCAGTCCAC
TCCTGCCAGCAAGTTCTCCCCCGTCACTGCGCTGCAGCCAATGATGCACCAGTGATGGCT
CTTGATCTCATCCAGGGCCAGGGCCTGCAGGGGAACAGGCATGATGAAGGTCGCAGGATC
AGGAAGAACATTGAGAGTGCTGAGCACGCGTTACCTCCTGGATTGCATCCTTGGACAGAG
CTCCAGGTAAATCCTGTTTGTTAGCAAACACCAGCAGCGTTGCACCAGCTAACCTCTGTG
CAGGGTTGGAAGTAAAAGACAACATACGTAACCAAAAATATCTTTCTCCAGAAGTGGGAA
ACAGGCTTCACCTCTTCCTGCAGCAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved