Takifugu_rubripes Locus Mono:3:SNORD15
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes Mono:3:SNORD15
Takifugu_rubripes
Mono:3:SNORD15
scaffold_188
SNORD15
1001..1146
2146
TTTCTACCAGTTCTTCAGAGTGGGTCGTCCTCTTCATTTGAAGACACTGAGGCATTTGT
CTGAGAAGGGTTAAGATGGTAGATGGTGCCTGTTTGGTGGTTCCGTTTCAAAAGAAATCA
CGGGAGACAAAAAGTCCATTTTAATTCTTGACACATTCCACCAAACATCAACATCAAATG
GCTCTACACTTTTACAGGGCGTGCTATGGTGTTCTGAGGTTCATCATGGAGAGCGGCGCC
AAAGGCTGTGAGGTCGTGGTGTCTGGTAAGCTGAGGGGTCAGAGAGCCAAGTCCATGAAG
TTCGTCGACGGCCTGATGATCCACAGTGGAGACCCAGTCAACTATTACGTCGACACAGCG
GTCCGCCACGTCCTGCTGAGGCAGGGTGAGTTCACCAGCAGCAACCTTAACATCGGCAAA
ACACGCACATTCTGACCCAAGTATCTGGAATTAGATGTTTTTATTCAGCAAAACTTGACC
AGCACGTCTGTGTACATTGATTCTTTAATTGACTAAACTTTAATACACACATGCTCAGAA
GATTTCAATGCAGCATTTACTATGATGTGAGTCCGTGGTTCCAAAAGGTATTTAAACAGT
GGATAATGTGCCGCATTTTTCCTGATATAGACGGTTTCACCAGCTTCAGTAATGTTTCCA
TACTATGGAAGTATGTTCAGGCCATGAACCTGTACTCTGACCCAGCTAACTGCTGATGGG
TCCTCCATAGGTGTGCTGGGCATCAAGGTTAAGATCATGCTGCCCTGGGACCCCACTGGT
AAGATCGGACCCAAGAAGCCCCTCCCTGACCATGTCAGCATCGTGGAGCCAAAGGAGGAG
ATCCTTCCCACCACACCAATTTCTGAGCAGAAGGGCGCCAAGCCAGAGGTGCCAGTCATG
CCCCAAGGAGCACCTGTACCCACTGCATAATCGGGTATGTCACCTGTGTTATGGTTATGT
TAGGATGTAAACACAAACAATAGAGGGTTTTGGTCGCGTCCCTTCAGTGATGATACGATG
ACGAGTCGGAACAAAGCCGTCTTGTTCTGGGGGTTGCTGGTTCAGCTCTACGTTCTGTGG
TTCTGTTCCAGTTCCTCAGTTCAGGGTCTTTTTCTCTTGAAGACATAGAGGCATTTGTCT
GAGAAGGGCTTGAAGTGTAAAGATCTCACCAGACAGCAATTCATTGCAGCAAAAACCTAG
CTGGCTAGTTATTTTAGCCCCTAATAACTGGGATTATGTAAAGGGTGCATTCACGTGACC
AATTTCATCAATAATCATGCCAAATGGTGACGACATACAAGAGACATGGTTCAGTTGTAC
TTTAAAATGTTTAAACGTTGTGCTTTAAGTTACGTGATGGGTTCAGATCACATATTTGTT
CAATACAAGTAAAAACTGCAACTTCTATCTCAAACAGCAGTTAAAACTTGAGACTGATTA
AGATGATCACACAACAAACGGGTTTTGAAAGAACTTATATTTAGCCTCATTTCCTTGTAC
ATCCCAGTGTTGGAGGCACCCATGAAAGTCACTTCTATTTAATGTTTCCAGCACCAACGC
TTGTTCAAATGTAGCAGAATTTAACCTGCAGTCCTGTGGACTACAACATAAAACACACAC
TTCCTTCTAAAGTGCATCTTTTCTGTTCACAGGTCTTGATTCATCACCAGCTGGCAACAA
GACCTTCTGTTTTTTGTGTACAAAAACAATAAAATCTGGAAAATGCCCAAGCGCTGTTAA
CTTTGTCTCCATCACCTTCAGTAAATAAAAGGTAACGTGGTTGGATGCCAAGAGTGACGA
GAATGACTCAAAGTAGCCATGAAGTGGTGCTGGTGGGGCTGAGCTGGAGAGCAGCTTCAT
GTTTTAGCACCATCAGGTTTTTGAGGGGACCGTACAACAGATCTGGCTGTCGTGGCAACC
AAAGCATTATTTCGGCTTCCTCGGGGCAAGATTGTCCACCACTGGTTTGTGCACCAAAGA
TGGGAACAAGTGGAGTCTCTGGATAATTGATGGCACTTTTATTGGGGGTGTTGGTTCCCT
GCAGAGCCTTAAATCCAGACTCAAGTAGTTTTCAATGTTAAATTCTCAAATACATTGAGT
CAGTCTAGACCCGATATTCAGGTTATTTTTAATTATGAAAATGTTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved