Takifugu_rubripes Locus Mono:1:SNORD99
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes Mono:1:SNORD99
Takifugu_rubripes
Mono:1:SNORD99
scaffold_61
SNORD99
1001..1078
2078
TGTAATGGGGTGAACATTTCTAAAGGTACGGTCTCCTTCCCCGCAGATGGAAGTCACCG
AAATGTCCAACGAGACGCCCACGCGCCTGAAAGCCGTATTGGGCTCCTCCTCATGGGCGG
CTGTGGCCCTCCACCAGGGAGCGGACCCAGGGGGTCGCTGATCATCACATGAGCCCAGAA
GGTTGAGGCCTGCTGACAGAATCATGGCTGACTGGGGCGAGCAGGAGCTCCATCCACCAC
TCCAGAGGTGAGCTCCTCCCCTGGGAGCCTGTTCCTGATGGCTCCTATCGAAGCCGCCCG
TGCACTCTGTAGCAGCGGGCGGTCAAACGGAAGCCGAGATGAAACCTTTCACCGACGGTC
GCTGTTCAGTTTAAAGTAACTGCTCCAGCAACATTTAGGGGAAGGACACCTGCTCTTGGA
AGCATTCAAGTCTGCTGTCTGCACATTCAGACGTCTAATCCTACTGTCTCTGCAGGTGAT
GCCGGACCTGGAGGGACCAGTGATGGCGGGTTTATTACCAGGTGAGTCCGCCTCCGTCCT
CCTGTAGACCAGTTCTGGCTATGATGACACACTTGCCCTCACTGAGATCAGGCTTGACTG
AGACACTCGTACTCTCCTGAGCCACATTTCCCCCCCTAAACTGTTGTTGGAATCACAGAA
ATTGGCCTTTAATGACTGTTTTCCTGCAGGTGCCCCCTGAAGGCTGGCTGGACCAGGCAC
CAGAGTCCTGCTGAGGTAATTTCAGTGGTTAGATGCTAACGCATGCTATCCTAAGGATCC
AGGCTTGTCTGTAGTTCTGGGTTCTCCATGTGCGTGCAAGAAAACAGGGCAGTCTTTGAC
TGCTGTGGCCTCATGTCATCAGCAGCCACTCAGCTGTCCGACAGTAGCAACTGTTGAGAC
TCCTTCAGTAACCAGTGATCTCTCTGCAGACCTGTGCTGAGCCCCCCCCCCACCCCAGCC
CACCTGCTGGGTAAGTTCAGTGACTTTTGGTCATTTGATGTTCTGATCTGTGATGACACC
AAATCAATGAGGACTGCTGGATGAAGCTTGCGGATATGGGACTGAGATCAGCCCAACGCA
GGACCTTCATGAGGAGCGCTCCAAAAAAATGCCAAGTCTTTATTTGCTGCTCTCATTCCA
GGGTAGAGGAACATCACCTGTCCAGAGAAGTGGCTACACTGGACATCAATGAAAATGCAT
CTTAAGCCAATAAAGAATCAACCTCATTTTTGTCTCTGCTTCATAACTTCATACATGACA
CAAGCTGCTTGGTTGAGTTTTTATTTCTTGACATGAGTTTAAATGCTGCAAACAGTAAAA
TGGGTATTTACATATAAGGCCACAGAGGCTGGGGAACTGGCCCCTATCCCACAGGTCTGG
GGCTCGTCACTCACTGGAGATGGACGGTAGCTTCAGCTCTGATATCTCAGAGTCTGGGGT
GCTGCTGCCACTCTGGTCACTGTAAGTGTCCCTGCAGCAGCACAAAATAAAGCTTAAGCG
TCAGCTCAAAGCCCAACACAGACATGGTGATGTTACCGTGGAGACAAGCGGCAGCCCTTC
TGCAGGTAGCTCTGCAGCTTCCCAGCTGAGGCCAGCAGCAGACCCAGGTAAGGAGGCGAC
GGCTTGATGGGCCGAGAGGTGAACTCGGGGTGATACTGGACACCCACGAAGTACGGATGG
TCTGAGGAGGATCAACAGGTGAGCGACGGTTCGGGGTTACCTGGGCAGGTGTTGCCAGCT
GCATCCTTACCATCAAGCTCGATGACCTCCATCCTCTCGCCCTCGATGTCCTGACCCACA
AAGCGGAAGCCCTTGTCTTCAAAGTGACTCTTGAGTTCTGGGTTCACCTGAGCAGAGGGA
GCCGAGCTCAACATTCACGCGCTACAACGGCGAGCGAGCGCGGCAGGATCATACGCACCT
CAAAGCGATGTCGGTGCCGCTCCTCCACGTACTCGGCGTCTCCGTAGAGTTTGCCTGCAA
AACAGAGGGTGGGTGAGACGGGCGGCGCCGTGGCGAGCTCGTTCTGAGTGGGTTCCTTAC
GCAGGATGCTGCTGGGGGACTTGAAGAGCGTCCGCCTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved