Takifugu_rubripes Locus Poly:0:snoR38
snOPY snoRNA Orthological Gene Database
Takifugu_rubripes Poly:0:snoR38
Takifugu_rubripes
Poly:0:snoR38
scaffold_112
SNORD49
1210..1283
2517
CCCGCAGGCCGGTGTGCGTTTGGCGGTGCGCTGCGAACTGTGAGCCTGTGCCTGCCTGC
CGTGGGACTCTTTGAGTGTCTTACAGCATCTTTCCTAGTCCAGAGTCTCTCCCTAGTGAC
CGAAACAAGGAATGGCAGTGATGGAGGAGTGTCGCTCCGCTCTCCTCGGAACACTTTTGC
GCGCCTGCTCTGACCCCAGGTGGCGTCAATCACTCAGCTAATTTAAAGTTGACCCGGCCA
AGATGTTTTATCTTACAAATCTAACCAGTTCTCCTCTTTTTGTGTAATTTTTTAACCACA
TAAATCGAAGTAAGAGGAGGCCAATTTTAGCAAAATTGGTTTGATCTCTCTTAGACGTCA
CCAGACGTTTAAACCTTAAAGAAAACATCGGGAGGTTTGTTTTATCCCCTCATTTAGCAG
ATATACGTTTAAAAATATTTGCATAATAAACGTCTCTCAGCGTGCCCTTCAAGAGTAGCC
TGGAGAAAATTAGTTTTTTCCTAAAAGTATATTTTGGTATGAGGGAGATACTAAAAAGAA
TAGGGAGTAATAAATATTGGGCATAGTTGTAATAAATAGAGCAACTTCTGCCACGCCCAC
GGATGTCACGTGGGTAATGACGTGCCGCTACATATCTGCCTACTTTGCCGAACTTCCTGT
CTCGCGCTCTGTGCTGGCGGCGTGAAGGTTGTCCGTGAGAAGGCACCATTATGCTGCTTT
CATATGCAGGGATAAATCTATACATTGGTCCGGATTTTTATGTAGATGAGCCGCCATGAA
CAGGTAATCTGATCTCTAGTTGGGGCAAATTCAAGTGTTCCGGAGGCGGTTATGAAGAAA
TATGCGGCCCTATTAGCCGTTAGCCACTACTGAGGCTAACCCGCACGTGCTGCAAGACCA
CGCCGGACTGACTTCTTTACTCATCATTCTTGCTCGGCTTAATGTTGCAAATAAAAGGTA
ATGTTGACAAAATAGCTGCTTGCTGTGCTTTTAACCGTCTGCGGTGCATATGATGATTTT
GTTATCCCTGTCTGAATTAAGTGTGGACACAATGGTATCTGATCTGCACAGTCGTGTGTT
ATCGCGTATTATAGTGTTTACAATCGGTAATGGGAAAAAAATTGTTCTGTTGCAGGCCGA
TCTTCTATTCCACGTGTGGATGAAGGAGTATCGAAAGGTTTGTACTAACACGTTTAGGAT
TCCAGTTGGTTTCAGTGATGAGAAGTGCTGCATAGGAAGTGCCGTCTGACACGATAACTG
ACGATGGCACAAGCTGCTCTGAGAAACCTGCCAAACCTTGTCTTTGGTGACTCTTAATCC
GGTTATGTGATCCATGCATCCAATGTCTTCTTACAGGTGTTTGCCTCTGCAACGTCGAAA
CTGCAAGATGGCACGTGGGCGTTGAAAGGAGAACAGGTAAATGAAGCAAGGCCTACAGTA
AAACACGATGGAGCCCATGATGATACAAGTTATCCCTGTCTGAACCTAAGTGTGGAGTCA
TGGTAACCTGAGGCTCAAGTGCTGAGACACAAGGACGGCATACTTTTTTTTGTGTTGTAA
CCATCTCCTTTACTTCTGACTTCAGGTACAAACTATGGCGGAGTGGACACGGGCTTGATC
CAGAAGACCGGTGCCACCATGAACATAACAAGAAAGCACTGATACAAAATTGTAACGCCA
CTATAGCTAAATCACTGATGGCCTGTGTGTGCAAGCATTCTCTTTAAATTTTCTAAATAG
ATCTTCTCCTCTTGAAGGTTTCCTTGGTCCTGTGGGCATAAGACATTTTAGGTCAGTTAG
GAGAAAAGATTAATAAAAGCACGTTCAAACAAGTCGTCTGTGTCAACTCTTGTTTCGCAT
GAAGGCAAATTCAGCTGAACATCTTAATCTGAGGAGTTAATTGCTTTTGAACCACATCTA
AACTCACAAGTAAATTATAGTACTTTGTGGGGCGATCAGTTACCTAGAAAGTTGGATAAG
TTCTCAAACACTAACTGCACATGTTGGTTATAAAGTATGTACACGTGGAGTGTGAGGCGT
TACCTTTTGTGCCATGTACCCCCACATGGCAACAAAAGCATCGTAACACATGGACTCTTG
GTCCAGGGCGGGGTTGGAGGGGGGTGGACATGCAGGGCTTGGCAATGGTGGATACAGATC
TGCAGATAGACAATTTTTGTCCTTTGCTCCATATTAAATTATTCCGTGGAGTCACTGAGT
CCATATCTGATCTAACCTGGCAAAATGGATGGTTCCACCCGAGGTGCAGCTGTGACTGGA
GGCTCAGTTCTCCACTGCTCCGACACCTTCTGCACTTGACTGATCCTCAACTGCTCCTGT
GTGTCAGAAGGGTCAGTGTTCAGACCAGATGGGCCCCTGATCCTCCCGTCGGTGATGACA
CATGCCTGCAGGACGTGCTGTTCCCGCTTCCACAGCTGCTCTTTCCGCCTGTGGATGTCG
GTGAGCTGCGCCTCATGCTCCGCCTCCACGCTCTTGGCTTCCTGTAGTGCGTGCTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved