Spermophilus_tridecemlineatus Locus NAP1L4
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus NAP1L4
Spermophilus_tridecemlineatus
NAP1L4
GeneScaffold_5966
SNORA54
8396..8518
18647
CGTGTTCCATGATATATGTTTCATGTATATCAGCATGAGTGCTCCCAAGTGTATACCTC
CTCAAGTACAGGAGGGATTATTTTATTGTTTTAAGAGGGAAATTATTCACCAAGTCCTGC
AGTCTGATGCCATGAGCCCGGTATTAATCCCACTCTGTGGTCAGAGCTGAGTGAAGGACA
ATTTCCACCCTGTGGGTGTCGTTTTATTCTGGGAATTTGGGATTGAGAATACCAGTGGTG
CAGTGTGGGACTGTGGGAGATGTCAGGGAGCAGGGTGGTGAGCATTGAGTGTTCTGTGGA
GGATAGGGGTAAAAGCATAAGGGCCTGGGGCGGGGGAGCAGCAGGGCAGAGGATGCTGGC
AGGCACACTGCCAAGACACAGGTCACTCTCCTTTCCTCAGCTAGGTGAGCAGAGCACACG
TGCATGGGTCCTGTTTTATTTGTCCCATATCCCTGGTCTTGGCTTCCCGCACACCACTGT
GGGACTGGGGGGAGGCTGCCAGGTAGCCAGAGATAGACTGAGCTTGACAATCGTGAGGGT
GCAGCATATCTACAGCAAAGAATCAGACACCTCAGGGCATCCCTGGCCACACAAAGAATA
TTGTGTGCTCCTAAAATAAAGCTTAACTAGCTGGGCATAGTGGTACATTCGTAATCCCAG
CAATTCTAGAGTCTGAGGCAGGAGGATCACAAATTTGGGGTCAGCCTGAGCAACTTAGCA
AGACCCCGTCTTAAAACGAAACGAGTTGGGTGCAGCTGAGTAGTAGAGCATCTACCTGGC
ATGAGCAAGGCCCTAGCACTGCCAAGGAAAAGTCTGACTTTTCAGAATGTGTTTTTAGGA
AGTCACTTGCTATGTTTAGAAGTTAGTGGCTTCACAAAACTAAGTCAATCTGCGTAGGAG
ATTTCTGTCCTTGGCTGTTCTGTGTGGGTGTGTTTTAAATACTTTTGGTCTTTTTTCTGA
CTCTTGATAGAAAAGCTCACAGATCAGGTGATGCAGAACCCACAAGTCCTGGCAGCTCTG
CAGGAGCGACTTGATAGCGTCTCTCACACTCCTTCCAGCTACATCGAAACGTAAGTATGC
TACAGGATGGAGTTGAAGAGACCTTTTCCACTGCCCCAGAATGAGGATAAGAGTGCAAAC
CTTGCCTAGAAGAGCCAGGTCCAAAGATGGGTGTCCTGCCCTGTGGTTGGACACTCATGG
GTGCAGGTGGAGTTGTCAGCTAGGAAGTGCGCAGTGCCACCCTGTGGCGGTGTGAGAACT
TCAACCATCACTGGCAGCAGAATGTTGTCTGGCTTCCCCCANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGTTGGGGGTGGGGGGTGGCCTCTGCCTGGGGCGT
GGGGACCCTTGTCTGGGAGACATGGTGCAGACATTCTTCTGGCTCTGGAGTTTCCGAGTC
GCCTCGGGTTCTAAGGGATTTTGTCTTCACACAGAGGAGAGAATTCATCACTGGTGATGT
GGAGCCGACAGACGCAGAGTCAGAGTGGCACAGTGAAAATGAAGAGGACGACAAGTTGGC
TGTAAGGTTTTGGGGAAAAATGAGTGGGTGGACTATGTGTTCTGTAAGAAACAACAACAT
GCCCATGGGCTTTTTTTTTTTTTTTTTAGTTATAGGTGGACAAATATCTTTATTTTTTTT
TTTTTTTTAATGTGGTGCTAAGGATTGAACCCAGTGCCTCATGCATACTAGGCGAGCACT
CTACCTCTGAGCCACAACCCCAGCCCCTGATTTGGTGGTTTTTAAATCATCAGTAAAGCT
TTTTCCAGAGAAAAGCGCTCCTAGCAACAGGTGCTTCTTCCCCCTCAGGTTGGGCACTTG
GGTCCCTGTGGCGAGCGAGGCACAGCTCCTTTCGGTGTCTCTGAGGCACTGTGTTGGAAT
AAAGGATTGGGTGAGCCAGGAACAGTCACACTCCAGTGAAGGTCATGGTCCAGAGAAAGC
GGGGGTCAGCAGGGGTGCCACACACCTGTGTCCCTAGTCACTGGAAAGCTGAGAGTGTGG
GGGGAGACCTCGTGGAATACACACCGCCAAGTGCAGCGCAACATGACAGTGTTTTCCTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAAGAGAGAGTGAGAGAGA
GAGAGGGGGACAGAGAGAGAGAGAGAGAGAATTTTAACATTTATTTATTTTTTCTTAGTT
CTCGGCGGACTCAACATCTTTGTTGGTATGTGGTGCTGCTGAGGATCGAACCCAGGCCGC
ACGCATGCTAGGCGAGCGCGCTACCGCTTGAGCCACATCCCCAGCCCCAGTGTTTTCCTT
TTGTGGTGCCGGGGGTGGGACCCAGACTCGACCTGTTAGGCAGTCGCCCTGCCCCTGGGC
CACACCCCATGCACATCAGCCTGATTTCACACTCACAACGCAAGTAGGTTTATCTTATAG
CATTATGCTTTTTTAAAATGTGTGTCAGTTTTGGTAGCCATCTATAGTTTGGTCTTTTGG
AAATGGGCAGGGCCTGGCCTGGTTAGAACTCTGACTGTGGGTGAGAATCCATTCCTTAGA
ACCCAGGACACCCTGCCTTTGCCAGCTGGGAAGCCCTGCGAGGCTGTTCTGAGCCAGCCA
GCCCTGTGACCAGGAACCTCCCTCCATGTTCCTTTTCCCTGGGGCCATGTTGTTCCAAGA
CCCCCATCCACGCTGCCAGGTGCCTCTGGTCACCACCCCATGTTTGCCCAGTACTTGCTT
ATCCACATGTGTAGCTGTGCAATTTCTCTGTGCTAAAGATACTGCTGCATGCAGCAAAGG
TTTGTTTTTCTTACTTCAACTCCCTGCCTTGCACCCCATTTTAAATAGATGTGGGTTCAG
TCTGCTGGTATTTGCCACCTTCTGGCTTTTCCCCCCACTGTGTACATTGTGTCATGGGTG
CTTCTGGATATAGTGGCTTGAGTGATTTTTTTTCCTTCCATGGTGTGGAGACATCAAGTC
AGAAGGAAGAAGTTTCAAGTAGAAGCTTGTGCAGTACTAAAGTTTGGCTCCACTAAGCCT
TCAGGCCAATTACTAATTTGTTTTTGTGACAACTATTCTGTTTTGCATCTTTATGGTTTA
GGGAGACATGAAAAACAAAGTAGTTATAGCCGAGAAACCAGCAGCAGAAGAGCCAAATCC
CAGAGGAATCCCGGAGTTCTGGTTCACCATCTTCAGAAACGTGGACATGCTCAGTGAGCT
GGTGCAGGTGAGCCGCTGCTGCCTGGTGGCTGGGAGGTGCTTTCCCTGGGCAGGCATTTG
GGTAGCAGCCCCGAAGCTCTGGGGGCAAGGCTGGCAGTGCAGGCGGAGTCTCACCCTGTG
TGGGTCGCTCCCCCTCCTGGGGCCACGCGTCACCCTCAGAGCCTGTTCACGGGTGGGGGC
TGCTCATGGGCTGTGAGCAGCAGCAGCTGAGGACAGGACCCTAGCGGGCGGGTCAGCCAG
CTGGAGGAGGGCTTTGAGTGTCTGCGCGTCTCCTCCTCGGGGTGCTGTTGGAAGGGCCTT
GTGCCCCTCACTGCATACGTGCAAAACAAGCTGCTGGTATGTTCTGACCATTGCCATTGA
AAAGTCTCTTTTTAACAAAAAGGAGTAGCCAGCCTTTCTGTGTCCCACTCACCCACCTTC
CTGTAACCAGAGAAGTGGTGTGTGACTTTCCTGGAAGTGAATCACAGAGTTCTGCCCTAG
CCTCATTGACTGACCTGCTGCACGGTCACAGAAACTGCACACAGACATCCAGGATGGCAC
AGCTCGACCCACAGGGCTAGTACTTCTGCCAGAGCACAGCCACCTTGTGCCCTGCCCGGA
GTTTTGTGATCCTGAGTGGTGACTTTGAGGGTCCCTTGTTGCAGTCTTTACTGCCTGCCT
TGTGAAGGTCCTGCCTGGCTTGCCTTCACTCACGCCACACCTGGGTAAAGGGCTGGAACG
AGCAGCTGCTTTGCTCATCCAGGCCTGGGTAGGCATCTGAAGTAGAAAGCATTGAGGTTT
CCTGATCCAAGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAAAAACCCCATTGACGGGCTGGGGCTGTGGCTCG
GTGGTAGAGCACTTGCTTATAGCACATGTGAGGCCCTGGGTCAATTCTCAGCACACATGC
AAATAAGAAAATAAAACCAAAGATCCACCACCAACTTAAAAAAACTGACAGCAGGGGGAG
TGCAGTCCCACCTCGGGAGGCTGAGGCAGGACAATCACCAGTTCCATTCAGACTGAGCGA
TTGTGCGAAACCCTGTCTTGAAATAAACTAAAAAGGGCTGGGATGTGGCTGGGTGGTAAA
GCACCCCCGGATGTGACCCCCATTACCAAAGGGAAGAGCACCACATCAGGGGAGCAGAAG
GAGGAAAGGCGGGTTGTGGGTCTGGTCAGGGTGGGGCCTGCGCGCTTGGCCAGGCACAGC
GAGGTGAGGCTCTGACAGGTAGTGGGAGATCTGGCTGCCATCCTGTGTGTGTGGCAGCGT
CACGTGGTGTTAGGGCAATTACGCTGTAGCGGCAGGTGTCTGCTGCGCAGGGAAGGAGGC
AGTTCTTACTTCCTGTGTGGAGAGGAGGTCACTTGTCCTGTTCCTCTTGATTCTCTTGAA
ATCTCTGGGTGGGGCTGCCTGGTGTCCTTTAACTCTGTGCTGGGGCATCTCTAGGATCGA
GTGCTACAGCTAGGCCCTGGGCCTCTTGGGTTCCCTGCTCACGGGTGCCTGGTGGCTGAG
GGGGAGAGCATAGCTCAAGTGTTGGGGTTGGGGACAGCAGTGCTCGTGCCGTGGTGGAGC
TGGGGCTGTTCACATGGCAGTTGCACAGCAAGCCCAGTGCTGTCTGCTCTGGCCCTGAGG
AACGGCCTTCCTTTCCGAATCGCGTGAGCAGAGTGGGTTTAGAGACCTGCTGGGTTTCTT
ATTACTGTGGCTGGCTTTTGCCGGCATCTTTTCTGTGCTATCACCAGAACTTAAAGTTGG
GAAGTCGGCAGTTACCAGATTGACTTCCTAAATGTCAGTGGAACCTGCAGGCTCTGGGCC
CATGGGCTTCAGGGTGAAGTGGCTCTGGTGGCGCACACCCCTTGACACACGCGTGAGCAT
TGCAGCTGGCCATGGCCGTAGTTTGCTTTTTTCATGGACTCATAAAATGATGGGTTAGGT
GAGCTCTGAGGTGAGATGACGGTCACTTGTAAAAAGTGCACAGTCACATGAGTTCTAAGT
TCTTGCAGGTTGGACAGTGGGCACACTTTGTGCTGTGGATTTGGGATCTTTACTGCCACA
GATGGGAAAGTGGCCACCAGTGTGGGTTGGTGGCACTATTTCTCTGTGTGTGGTGGCAGG
TGGCACAGGAGAGCAGGCAGGTACCAGAGGTAGTCTTACAGCCAGCATTGATGGTCACTG
TTTTGCCAGCCAGAGATAGATGGCACATGGTTCTTGGCATATGTTGTTGCCATCACTGTT
GGGAAACAGGTGGGGCCAGCCGCTGGAGGTGGGTCCTGGGGCAGGATCCAGGTGGCCAGC
CACCCTCGGGCATGCCCACTGCCCTACCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTGGGGCCCTGAAGTTGGGAAGCTGGAGGTCCCAGACCCTGTCCACCCTGT
TGCCCAGGCAAGCCCTGAGAAGGGATGTTCCCCAGAGTCAGGCCTTCATAGCCCTGTGCC
CTCTGTGCCTCACTGAGCACTGGAGTTGAGTGAGTGGCAGCATGGCATGGGCCACGTCCT
GCCCTGAGCATTGTGACACACAGCTCCTCAGAAACCTGTGGTAGAAGGACCCCTAGGGCA
CACAGGTTCAAGACCAGCCTGCGCAACATAAGGAGGCCTCATCTCAAAAGGGAAAGGATG
GGAGGTGTGTGCACCAAGAGGAGCACTTGTGCGGAGGTCCCAGGTACTGAGGAGGGACCT
GTCAGGGTTCAGGCTTAAATGTAATGGCAGATGCGACTGAAGAATGCTTTCCTACTCTGG
TGTCACAAGACATCTTTCTAGAATGACCATCCCACAGGAGTGTCAGTGGGAGTGGGCCTG
CCCTCGGCCGTCCCCTGGCCCTCCAGGTTGCACTGTTCGTAACCCTTCAGCCTGGCTGTG
GCTGGCGGGTTCCATTCCAGTGCCACAGCATCTCCAGCAACACATGACTGACTGACCAGT
GGCTTTCAGTTTCAGGTCTTGGAGACAGTGTTTTAGGAGGGGCTGTGGGTTAGGGATCTT
CGGAGCCTGGGACCTGGGACTGGTTCTGTGGCCTGCTTGGCCTTCTGTGACTTCTCCCAG
TCTGGTGTCCAAGGCGCCTGCAATTCTGAGGTTCTGTTTTCTTGCTCTTTTTTTTTTTTT
TAAAGAGAATTTTTAATATTTATTTTTTAGTTTTCGGCAGACACAACATCTTTGTTTGTA
TGTGGTGCTGAGGATCGAACCCGGGCCGCACGCATGCCAGGCGAGCGCGCTACCGCTTGA
GCCACATCCCCAGCCCTGTTTTCTTGCTCTTCTCTCTTGCCCATAGATCTTCCAGATGAA
GTTGACATTTTCCTCTGGGGCAGCCCCTTTTTCTCAGTGGACACTTGCTTGGTGGTTGCC
GGGGTCCCTCTTCCTTTCTCAGCATCTTCTTGTCTTCCACCTCACATGGCTCTTAGACTA
GAGCCTTGGTGTAGGCTTGTCACCTCCTCTTTCCCTCTTGTCTCCCTTGTTATAAAAGCC
AGATGTGCTTCTTAGGGAGACCGTAGAAAGCAGAGTGTCCCCTTCTCAGCAGCTGTCCTC
AGCTCTGCGTTTCCCCACCGCCTTTCCTTTAGAAGTCCTGTGCAGATCCAAGAAGGCAAA
ACCGCCTGACTCCAAGGGGGCCACCTGTGCAGAGGCGCAGGTCACTCCTGGCTGGGGAGC
TTGTGTGGCTCTGGCCATCGGCTCTGTGTGACCTTCCCCAGGTGTGCCAGCCACGACTCA
CTCGAAGCTCCTTGGTGTGAGGAGGTGGAAGAGTGGCCACCAGCTGCCTCTCTCCCTGCT
GGGGGAAGTGGTCTGATTTTGGTTACGTTCTTTTGTTGGGGTGAGGCTGGCGGGTTGGGG
TGGGTGGCATGCCAGGTTGTGGCAGGTCGGCAGGGCAGTCCAACCTTAGGTCTCTTCTCT
CTTGATTAAGCAAGGGCAGCAGGGTTAGAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTCTTCAGAATCACCAAAAAAAAAAAACAGAACAAAACAAACTGCATAT
GAGTGTTTTGTCGAATGAATAAGTCAGTGCGGATCAGTATTGCTCTAGTGGTCTTTTTTG
AAATTGGCAGCGTATCTGCTGTTTGCTTGGGTGATTTTCATCTCTGTAGACCACCAAGGA
CAGACTCTGACTTAGGAAATTGTTCTATTTTGAATTAACATGCTAATGCATTAGAAGCAA
ATATTTATTGTTGAAAATCTCTCTGTGTAAGTAGTTTGGAACTCTTTATTAAAATACCAC
TAGGCTTGAAGGACTGGGTGATGAGGAAAGATGGTCACAGGGCAAGGCCTTCATGCGGAA
GGGCCTGGCCTTCCCAGGTGTGCTCTTGCATAGATGACACCCAGCTGCTATTAGGGCCAT
GTGTGTCCAAGATGACAGAGAGGCAAAGGTGGGCACATCCCAGGCCCTGCGTTCCTCACT
GGTTGTCACCTGTCACAGTGGTCCCTGTTGGTTGACTTAGGACTTTGAGTGCAGGTATAT
GAGCGTGACTCCACATGTGCTCTGGGCTTGGGTAGCAGTTGGCAGACAGGGTCCTGCTGT
CGTGCAGACCTGAGGAGGCCTCGACACAGAAAACACACTTTCACGCTCCGTGTGGGACGC
CTGGGGCATGGGTGCCCTCCTGCTTTCTGAAGTCAAAGCAGCAGCAGGGTTCCAGCCCTG
GAGCCCATGTGGGCTCTCCTGAGTGGCACCACTCAATGGCCATCTCCCCTACAGGTGCAC
CATTGACTGGAAGAAAGGAAGAAACGTCACTGTCAAGACCATCAAGAAGAAGCAGAAACA
TAAGGGACGGGGCACTGTCAGGACCATCACTAAGCAAGTCCCCAATGAGTCATTTTTCAA
CTTCTTCAATCCTCTGAAAGGTCTGTTGGCAGGGCTGCTGGCTCTGTCCTGCACACCGTG
TTGTGTGGCTGTGTGACGCGGAGTATTCCCAACTGTCTCTGCAGGGAATGGCGGCCGCAC
CCCAAGTTGCGCTGGTGCCCAGGCGAGAGGCAGGGTCTGGGGCGGTGGAGTAGGAGTGTC
AGCCGCAGGGGAAGAACAGGCCTTTTCTTATATCTGCCTAGCTAGTCCCAGCCAGGAACC
TATAGCTGCACTCCAGGGAAGCCAAAGGGGCACCTGCTCCACTGCTGTTCCTCTGCTGCT
TCCTGGGCACCCCTGGGGAGACAGAGGTCGCTCTGCAGGACCCCTCTTGACCTCTCATCA
TCAGGCCCCTTTCCTTAGCACACTCTTCCCTCCTGCCTCCACGTCAGACACAAGCTGGCG
CTGGCTCCTCATTGGCACATAGCATGTCATGCACATGGTGCGAGGGTTGGTTCTGCATCA
CCACCAACTTCACTTTTTTGTGGGTTTTTTTTTTTTTTTTTTTTTTTTTAAAGAGAGAGA
GAGGGAGGAGAGAGAGAGAGAATTTTTTAATATTTATTTTTTAGTTCTCGGCGGACACAA
CATCTTTATTGGTATGTGGTGCTGAGGATGGAACCCGGGCCACACGCATGCCAGGCGAGC
GCGCTGCCACTTGAGCCACATCCCCAGCCCCTGGTTTTTTTTGTTTGTTTGTTTTTGTTT
TTTCTTTTTTTTTTTCTTTTTCTTGGTACTAGAGATTCCGCCTCCGGCACTTGACTACTG
AGCTAGGGATTCTACCCTGGGTACTTTGACTACTGAGCTATATCTCCCATTCTTTTTTAC
TTTGAGACAGGGTTTCAGTAAGTTGCCTAGGCTGACTTGGAACTCACCGTCCTTCTGATG
TGGTCTCCCAAGTGCTGGGACAGCAGCATGCCGTTGTACCTAGCAGCACATAGAGTTCTG
CAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCCATGACTGGGCA
GAGCAGACGGGCCTGGGGCAGCGTCACAAGTGGGTGAGATGGCCAAGGCTCCCTCGGCTG
CCAACTGTCTGTTCTGTGCCGGTCGATCGAGCTTTCTCCTCTGGGTTTAAGACTTGGTTG
TCAGTGTAACTCAGACTTGTTTTGCCTTTTCGTTTTCTAGCCTCGGGTGATGGAGAATCA
CTGGTAAGATGTGTGTTGTCAGAAGTCTTTATTTCCTGGGGGACTGCCTGCCCTTTCTAA
TCCATTCCCGCTCCCATAGGCCCTGGGGTTCATGTGAAGTTCTCGCACCTGGGGGTGGCT
CTCCACCTTGGCTTCAGGAATAGACATTGTCCTTCTGTCCAGCCCATTCCCCCTGGGGCT
CTGATACCCTCTACTCTGAAACCATTGGGCAGGAAAAGAGCCATAGGCCCACTTTGGAAA
TGCCTAAGCTCATTTTGAGTGGCTTTTGTATGTGGTAGCCATCACCCAGAAGTGCAGAAA
TTTGGTGTTTGAAGTCCAATAAACCAAAAGGGAGGGGGGTGGAGTGTTTATCTCACTGAA
ATGAGCTAACGTGTTGGCTTTTCCCTCTCAGGATGAAGATTCTGAGTTCACATTAGCCTC
AGATTTTGAGATTGGACACTTCTCCTGTCAGTGGATAGTGCCTGGGCTGTGCTCTGTTTC
ACTGGAGAAACCATGGAGGATGATGACAATTTTGAAGAAGGCTAAGATGGAGAGGAGGAA
GATGAGGATGATGCCAAAATTAACCCCAAGAAAGAGCCCATCCAGCAGCAGAGTACAAGT
CACAGTGAGAAGCTATGGCCTGGTTGGCACCAGTGGACAGCTGCCAGGATGTGCCTGGTT
CTGCTGCAGCACATGGACAGTGCTCATAACATCTAATGCACTTTCAAATGCATGACTTTG
AAATTTCCTTGGGTTCTGTTCTGGTACCTGCAGCTTTGCGCTTTTCCAGGCCTGCCTTGG
GGGCCATAGAACATGTGGATGGAGTAGGGCGGAGGGCCTATGTGCCTCCCACGGCCCTGC
TTTGATTTGAGGAACCCACACTTTTGATGATACTGAGCCTGCTGAGAGCTGCTATAGCTC
TGGCATCCTGGCAATCTCAGTTTTTAGAGTGTTTTTTTTTTGCGTTGTAGTTTTCAAGGG
AATGGGTGGGTTGTGGCATGCACCTTTGAGGCAGGAGCTTAGTATCCTATCCTCATATTT
ATTCATTGATTCTTGGAGGACTTTGAACTCACGCTGCCACTCATGTTTCCTGTTAGTGAG
ACCTGGTTAATGGCTGGTCACCAGAGTGTGTTCCAGTGGGAGCACTGCTTCCTGTGGTGC
TGCTGAGGGCAGGAGCTGCTTCTGTGACACACAAAACTGGTGCTGCTGTGTGTGGTGGTA
GCCAAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTCACTGCA
AGTCAGGTCTTCGGCTCTTAATCGTGAACCCATGGATTTGAAAAGCCCTATGGGCGGTGT
TTGCTTCTGCTGAGCTTAGAAGGACCAGCTCCTGCCCAGCTCCTTAGATGAGTCCTTTTC
CTCCTCTTAGTCATGGTGTGCCTGTACCTTAGTGTCCTCCTCTATAAAAGGAGCTGATGG
CAGTGACGCCCCTTGTGCCAGGCATTTGGGTTTTAGCAGGTGCTGGTGTAAGAAGTGCCT
TGTGGATGTTCAGTGCCGGAGGAAGGGCAGTGGTATGCTTGGTTCGATAGGCCTCAGGCC
CACACCAGAGCCTCCGCTGGGTAGGTTCCCTAAGCCTGAGAGGCTGGTGCTTGGATCTTG
GGGACTTGGTGCATGAAGTTCTTCATGTGTGGCTTTCTAAAGTGCAAGGTGCAAGTCACC
CACTGCCACTCAGGAAAGAGGAGGAAACACGTCTCTCTGTAGCCAGTTTCCTCAGTTGCT
GTGCAGTGCCCGAGGGATGTCTGTGCCCCGGAAGTCTGGCCCATGCCAGGAGCCAAGGCT
CTGCAGCCCGCACCCATGGGGTTGCATTCACCTTTGCCTCTGTCTCGTGTGGAGCTTGAA
TCTGAGTCTGACCAGCCGTGCGTTGGGTGGAGGCCGTGTCGACCAGGACAGCTGGCTGTA
AGCGGAGGTCCTCCTCCGGCTGACTGTAGGGTGGAACACCAGGGCTTATTGCACTGCTTT
TGGATCAAGGCCACTTTGCCCCTTGCGTGAGGTATGAAATGGTACCAAAGTGCCTGCATG
TGATAGAATTATGCTAGCAGTCATTTAACTCATCGCCCTGCAGACACCTATTCCTGGCAG
CCCTGCTTCAGCATGAAGACCACAGTGGGCCCTGGGTCCAGCAGGCGCTTGCTGGCAGCT
CCCTGGGTAGCCCTCCCCATCCTTACCTCTGGTCTTTGAGTGAATTTAGGTTTCCCACAT
CCTAGGAAAATGCAGAGCTCATGAGCACCTGGCCCCCTCCAAGCAGGCGGTGCGCGTCCC
AGAACCCAGGCAGCCGCACACCTGCCTCCAAGTTGCTGGGGGGCCAGCACCGCACAGCAG
CTGGGCGTCTGCTCTCCAGACCAGACTGGTGGGGGTGCTTGGTGGGGGCTGACGTCTAGG
GCAGCGTGACCATGGTTTTCCACACCTGAAAAGGCTTTTTCATTTTCTCCCCCTCCAGTT
TGAAGAAGGCGAGGAAGGAGAGGAGGAGGTAAGGAACCCAGGCAGGAAATGTCATCCTTC
CCTCACGGTGTGAGTTGCAGGCCACATGGTGCCCTCTCCCCATGGGGTACCTTTGACCAG
CAGTTGCCTTGTGAAGATGTGCCTTAGAGAAGTTCCTGAAGGGCTGTCACCTCCCTGTAA
AGAAGCGTGTGCCTTGCTGGGTTATCTGAGGAGGAGACACCCCAAACGGCTTGCCTCCAG
GGGAGGAGAGCAGCCCTGGTGGGCAGTGCCACCCACACCCTCCTTCTGAAACAGGGTTGC
TTCTGCATAGTGGACTCTGGGAAGTCCAGCCTGCAGTTGACTCTCCTGGCTGACTCACTC
CTTTTCACACAGGAATTGGAAGGTGACGAGGAGGGAGAAGATGAGGATGATGCCGAAGTT
ACCCCCAAGGTCAGTCATCCTGAGGCTCCTGACCTGAGCAGTGCTGCACTGCTGGACTTG
GACCGATGCTCCCCACTTTGGGGCAGTGGCGGTGCATGTAGTTGTGTGTGTGATTTTCTA
CTGAGAACACTTAAAATGTGTCAGGAAAACACTGGGATGAGGAGCTATCTGGACCCTTGG
TGACAGGTTTAGTACAGGTGTTCAGGAGAGAGCCTCAGGCCTTCCTGCAGCCGTGTCTCA
CCTGCAGAGTCCATCAGCTGCGCACCTTTAACTCCAGATCTCACCTCTCGGGGATGATTA
AACTAACCACTTGGCCCGCTTGGGTGTGGTGGGGAGAGATGTGAGGAGGGGGCTCTGAGG
GCTGCTGTGGCTCAGAGGCAGAACAGTGGACGCGAGGACATCACCTAGCTGTCCTTGGGC
TGAGGGTATTGAGAAGACAGCGCAGGTGTCTAGACGTGTCTCAGGTAGCCTTAATAAACG
ACAGAGTTCACTGAGGAGATTTAAAGGGAAGGCGAGAGAGCGGCCCCTGGTTTGCCTGGA
CCTGGTCCTCCTGGGGCCTCGGGCACACACCACCATCCAGAGCTGCACTGGTGCAGGGCT
GACCTGTGGGCACCTCTGAGCACAGGGTGAGCTGTGGGCTGTGCTGGCACCTGGTGTTTC
CGGGGCCTGTCTCCGACTAGCTGTCCTTCCCTGTCTGTGCTGTTCGCCTGGGTGGAGTGT
GCACTCGAAGCTGAGGGTGCAGGGCCGATATTGAGAGGAGCACGTGCGCACAGTGGATCC
CTCAGGAGGGTGGAGAAGGGCTTCTCAGAAACAGGCTTCACAAATACCATCCGGCGAGCT
TGGGGGCGCCCCTCCCATAAAGGTTGCCCTGTGGGCCACAGGCTCTGCGCTACAGTGTGC
TTGGCCATGGGTGATGGGCTCCCGTCCGCACGCAGTCCACTTGTGGGGTCCACTTGTGGG
AACCAAGACATGTGGCTGCCCTGTGGGCGTGTGGCGGGCCTGAGGCAGGTGTGCGATTGG
CCGGGTGAGCACATGGTCTGATGTGGGTGGAGGGCAGGACTGGAGACCCCTGCCAGTCCC
TGTCCTCGGTTCCGTGGCCTGTGTGGTACTTGTGTCACTGTTCTGCAGGCTCTGTTCCTT
CGTTTCTTCTCCCGTGTCATGTCCTCCCTTCTGTCTCTTCCCATGCCCGTTTCTGAAGGA
GCATCTACCAGGTGGCTCCAGGTGGTCAGCATGGAGCGAGTCCCATGCTGACCCCTGCAG
CCTGGTTTCGCTGCCCGGGTTGGGGCGTGGCTGGGGCACTAATGGCTGATGGGCTCTCCA
CCACATTCCCGAGTTGTCCGCTGTCCTTGGCTCATGGTGCCCTGTCTCCCCTCATGTGCA
CCTGTCCAGGGTGTCTGCAAGGCCAGGATGGGGGGTGTGGCTGGTGTTGGGGTGACCACG
CTCTGGAACCAGGCCCTGTGCTGGCCTGCTGGAGGGACAGCTCTGCTGCGTTGAGTTGCC
CACATCCATTACTCCGCGGCCCTTCTGTGTTAGGAGATTCGTGGCTGTCTCTTCCTGTAT
AATTTTGTGCATTTCGTTTTCTTTCATGCTGACGGTTCCTTTCAATTTTTTTCCCCATTT
AGGTGTAATTTTTGTCTGTTAATCATTCATACGTTCCTAGGTAAGGTGGAATCCATTCGT
ACCTAACTTCCAAACTGCTGGTCTGTACTTTGCCATGTGATGCTTGGACCTGGGGGACAC
AGAAAGTCGCCCTCCTGGCATACGTGGTGTGCTGCAGGGTGCACGGGCTTCCCATGGGGA
GTGCTTTGTGCAGGGCCCGTGGCTGGTCTTGAAAACCAACAGGCAGAAGCTAAATCTGGC
ATCTTCCTGAGCCCTGGGTGGCACTGCTGGTGAAGGAGTGGCCCTGAGGCCTAGGGGCAC
TGCTAGTGATGGTGGTGCTGCTATTCAGGAGGGACCACAACAGGCAGCCCCAGGGTCAGT
ATTTTGCAGATCAGAATGGTCCTGACATACCTGTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGGTGGCACTGGGTTTGGCAGAGATCCTTGCCATGCACCAGACCCTC
CCCTGAGGAAGAGGAAAGGCGGGAGCAAGAAGTCACAGCAGAGCCCCTGCCCATTGGCAT
AGGCAGACTTTGGTTTACCAGGGGAGCCCTGGACCTGGTGCCCTGAGCCAGGCCAAGTGC
ATGTCGTCCATCAGTGTTGAGCGTATTCTCCCCAGGGGCCTGTGGCCACTTGGCTGTGGC
CCCTGTCCTTGGTGTAGCCGGCTATGTTAGTGGCCTGGCTTTACCCTCCCTTGGCCTGAC
GGGTATCCCAGAAGCCCAGCTGCAGGAGTCCCATGGTGGGCAGGATCTGGTCAGGTGACT
GCCTTTGAGAACATTGGCTCCCTTCTGAGCAGTCGTGTTGGCATTGAGTGAGCAAGCTCT
GATCAGAGGTAGTGACGTGCGAGTGCTGGGTGTGGCCCAGGTGTGGAGCACTTGGTCTAT
GGCCCAGTATGCGCAAGGCCCCAGGTTTGATCCCCAGTACCAAAAATA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1098, 2211..2352, 3363..3449, 5010..5135, 6073..6144, 10151..10290, 11723..11867, 11876..11880, 13046..13047, 13089..13111, 13500..13568, 13571..13621, 15627..15656, 16001..16057, 17671..17676
1001..1098, 2211..2352, 3363..3449, 5010..5135, 6073..6144, 10151..10290, 11723..11867, 11876..11880, 13046..13047, 13089..13111, 13500..13568, 13571..13621, 15627..15656, 16001..16057, 17671..17673
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved