Spermophilus_tridecemlineatus Locus ENSSTOG00000011857
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus ENSSTOG00000011857
Spermophilus_tridecemlineatus
ENSSTOG00000011857
GeneScaffold_3197
SNORA70
1950..2084
3526
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTTATCTTTTGAGTCTGGAATTATAAAATACTGGCTTTAAAAGGAGTTTAAA
ATTAGGTGTAATCAAGACATTGTGGCTTTGGTTAACTTGCTATATTGTTGATGCTAGCCT
CAAACTTGGGATATTGAGCGAGCATTTAAATAGCTTGTTGGATGGGGCTGGGGATGTTGC
TCAAGCGGTAGCGCGCTTGCCTAGCATGCGTGCGGCCCGGGTTCAATCCTCAGCACCACA
TACAAACGAAGATGTTGTGTCCGCCGAGAACTAAGAAAAAATAAATAAATGTTAAAATTC
TCTCTCTCTCTGTCCCCCCCCCCTTAAAAATAAATAAATAAATAGCTTGTTGGGTTCACT
TTTGACCCCTCCACATCAAATTTTTTTCCCCCTTCTGCAGTTACCGGTACTGTAAAAACA
AGCCGTACCCAAAGTCTCGTTTCTGCCGGGGTGTCCCTGGTAAGTACTAAGACACTCACA
AACTGCTTTGGTCATGCTAATTCAGCAGTCCCTATCACTCTACCTTCCCTCCCCCAACAC
TTATCAAAGTTTTTTTTTCTACCCCCAGATGCCAAAATCCGCATATTTGACCTTGGGCGT
AAAAAGGCAAAAGTGGATGAGTTCCCACTCTGTGGCCACATGGTATCTGATGAATATGAG
CAGTTATCCTCTGAAGGTGAGGCAAGATTCTTTATTACCCCTAGTTCTTTCTGTGTTCTC
TGTCTGACCCAGAATTGTACCACACTGGCTATAGTGAGTGCTTTTGCACCATATTGTTTT
AACTCTGTTGCCTTCCTTTGTTCTCAGCCTTGGAGGCTGCTCGTATTTGTGCCAACAAGT
ACATGGTAAAAAGTTGTGGCAAAGATGGCTTTCATATCCGAGTGCGGCTCCACCCTTTCC
ATGTTATCCGTATCAACAAGATGTTGTCCTGTGCTGGGGCTGACAGGTGAGTTGGCTTTG
AACCTTTTCCTTTAACTTGGGCCTCTTCTGGGCTTGGTTTTTCATGTCAGGGAATAAAGG
TGATTTCACATGTTGAATCACCTGTGGTGAGGGAAAAAAAAACAGGAGAAAGGCTGGCAA
TCAAATTGGGGGTACCACCTCATGGTGTCTCACTGTTTTTTGTTTTTGTTTTAATTAATT
ACACATGATAGTACAATGATCTTGACATCATACATTTGAATCAGATGGGGTATAATTTCT
CATTTTTCTGAGTGTACAGGTTGCAGAATCACATTGGTCATGCAGTCATATATATATATA
TATATACACACACACAGAGCAATAATAATGTCTATTTTATTCTGAGGTTCCTTCCTTTCC
CCCCCTCACTGGTTCTTTTTGAGTCATCTTCTGCAGCTAATTAAGCCGACTGGGTTCCTT
TACTTGTGGTGGCCCAGTGTGCAATGGCTGCAAACAGCAATCTCCTTGGTAGTGTATGCA
GCCTGTTGCTTGTATGGGTTGCCCTAAGGGACCTTGGAGACAGCACTATGAGTAGATGTT
CATATTTCTGATCTCATGATGTCCCCCATCTAGGCTCCAAACAGGTATGCGGGGTGCCTT
TGGGAAACCCCAGGGAACAGTGGCCAGGGTTCACATTGGCCAAGTCATCATGTCCATCCG
CACCAAGCTGCAGAATAAGGAACATGTGATTGAGGCCCTACGCAGGGCCAAGTTCAAGTT
CCCTGGCCGCCAGAAGGTAAAATAGTGGTGCAGCTCCCTTCCTCCTACCTACCTTTCCTT
GCCCCAGTCCTCCTGACTCACTTTCCATCTCTAGATCCACATCTCAAAGAAGTGGGGCTT
TACCAAATTTAATGCTGATGAATTTGAAGACATGGTGGCTGAGAAGCGGCTTATTCCTGA
TGGCTGTGGAGTCAAATATATCCCCAATCGTGGTCCCTTGGATAAGTGGCGGGCCCTGCA
TTCATGAGGGCTTCCACTGTGCTGTCCCCTTCTTAATCACACACAACACCAATAAATCCT
GTATTGTATCCATTTATGTGTTTATTTCTTAAATCTAAGGGCCATGAAACCATAACCATA
TTAGCAGTATAGAACTGTACTGATAAGCTTTATCAATCGCCTGTTTGGGATCTCACCCTA
GGGAATATGTGGAAAAGCATTAAAACTGGGGTGGGTGGTAATGGAAGGGTAGAAGCTGGG
TCCCTTTTTGTAAGCCTAGCAGAATCATTTCCTAAGTATCACCAGCACCATGATAGGGAA
TGGGCAGAAAGGAATCAAAGTGGATATAGTGGTATGTACTTAGGCAGGATCTTTTTTTTT
TCTTTTTAATTTTTGGCATCAAGCATTGAACCAGGTGGTGCTTAACCACTGAGTCACTTA
CCCAGCCCTTTTTTTTAATATATATATATATTTTTTGTGGGCACATCTTTGTATGTGGTG
CTGAGGATGGAACCCGGGCCACGTGCCAGGCAAGCACGCTACTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNATCATAATGAGTCCACAGGTCGCATTTTGGAAGCGTC
TACCTTCAGCAGCTACTTTAGGTACCTAGCTCTCCCAAGCACAAGGCTGTGACCCCTTTG
AAGCCTTTCTACTTTTGTAATCTTAGAATGATTTTCCAAAACTTTTCCAATAAATTCCCT
TTTAATTTTGACCCCAAGGAGATTGCTCTAAACCATGATTATAGTTTACATAAACATATT
ACCCTGTAACTGTCCCAATGGATGAGGAAGGATGAGTTCCATGATACTAACATCCTGGAC
AGGGTCTCTGTTCTGTGTATTCTTTTCTGTAGCCCATTTTTCTGGGCATGTGTTCATACA
GATAGCTTTCCAGTAATATGATAGTTGTGGTTCAGATAATGTATACA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1058, 1168..1275, 1407..1545, 2133..2295, 2374..2526
1001..1058, 1168..1275, 1407..1545, 2133..2295, 2374..2523
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved