Spermophilus_tridecemlineatus Locus ENSSTOG00000014618
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus ENSSTOG00000014618
Spermophilus_tridecemlineatus
ENSSTOG00000014618
GeneScaffold_1137
SNORD34, SNORD35
3836..3905, 4100..4191
5736
ACGGGTTATGAATGGGACGGCATAGGGCTTGAGTCTTGTTTAGTTAATGCAATGTTTCT
GTTCAAGCCTCTTGGGGCCCAGAGCCTGTGCTAGGCAATTCTAAGACCCAGATGTGAGGC
AAAACCAGCCCAGGGCTCTGGCGCGCCGGGTCTTTGGAGGAGTCCCAGGGCACCCCAGAG
CCGGGGCAAGATAACACACACTTGAATAAAGGGAGCACAGACAGTGTGGGATCCCCCAGG
AGGCATCTGGCCCAGGCTGGGATAGATGGGGAGGCTCTCTGGAGGAAAGGACTCATGAGC
CCAAAGGCACTAGGATCATGACAAGACAGATTCTGCAGTGAGCGTGGGCGGAAGAGCAGG
GAGGGCATCCCAAGCAAGAGAGATGGCAGAAGCAAAGGCCAAGAGTCTGGAAAGCTGCTT
TGGGATCCGCAGCAGATTGGTGCAGCCCCGGCATCTGGAAGTTATTTCTTCATCATCCAC
CTCCACCTGTTTCACAAAGGCGGATGCCGGGCCCAGATAAGTGCAGCAGTTCGTCCTGCT
CACCACGAGGCCTACCAGGCATCAAATCCACATCCCCTAACCTAGACTGAGCGCCTAAGG
GCTGCCCAGGCGGATCTGCTTGCCCCCTGCAGGCCATCACGTACCCTGCAACCCTCAGTC
GCCTGATGGAGTAACGGCGACAAGTCGACTGGAGTAGATCAGCAGCCCCTCAAAAAGATG
GCTGCCGAGCCTCGACAGCCCCACCCGACAGAACCGCCTCACGACCCACGTGATCTCTAG
CCCCTCACAGGCATGGCCGCCCGAGGTCCGACCGGATTGGTCAGTCAGAAGACCGCCCGC
CTTCCCCCTAGTGCATCTTTGCGCACGCGTACAGCACTTTAGCCAATGAGAAGACAGAAA
CTTCTCCGCTCCGCCAGTGTAGCGTTGCTGCCTCCGCCCTTGCGGCAAGGGATAAGAAAC
CCTGCGCCAACACTTCCTTCTTTCCCAGGCGGCTGCCGAAGATGGCGGAGGGGCAGGTTC
GGTGTCTGCGCGGCTGGGGTGGTGTGGGGTCGCGTGGGATCCAGTCGGGAACAGAGTTGG
GTCCAGTATTGCCTTCTACATACGTTGTGAAGCTTCAGATCAGCAGTTAACAAAAAGGAG
CTGGTTTTAGTGGGTAATCCGTAGGGATGTAGGAGAAACCGCGGCTGTTTTAAGGTCGAG
GAGTGGCTAAAAGGCGGCAGTTTATTCCTTCTCAAGGCGAAGGGTGATGGTGAGAGTTTG
TTTTACGGTTACGCCTTCCTTGTCTTAATCTTGGGTAGCGGGTGGGAGCCCTTGGCGTCA
GGTCTTTGTTCAGACCCCGGCCATGGGGAACACGCGGCGGTCTGACTGATGTCGGGCGAT
GGGAACCTGAGGCTGGGCCAAAATGGAGGCCACTGCCGTTGTGCCCAAGGCCTAACTGCT
TCAGCCTGATTCGGGATCAAGGTTTCCTACAGCTTGTGGCATTTCAATGCGAAATTCCCT
TATGCAGTAGGTTAAGAAAACTCGCCTTCCCAGTGTTCAGGAATTGCTTTATTTTCCCCC
TTGTTTTGGGGTTGCTGGAAGTAGAGGGCTGTTAACAGTTCCACAGCTATAGGACAAACT
ATCGTCCCCCAAATCACCCCCAGGCCCTCAGGGAACACCGTAGAAACTTAGCTCTGTGTC
TTGTGTTGAACGTGTACCCAAGAGGGTGGTCCTTGGGGCTGGGGCTGTAGTCTAATGGCA
GAGCGCTTGCCTAGCATGTGTGAGGCATAATTAGAGGATGGGGGCGCTGAGGTTGTGGCT
CAGCGGTGGAGCACTAGCCTGGCATGTGCAGGGCCAAGAGGATGGCCCTGGAAGTCTGTG
GTGTTTGGGCTCATTCCCAGGTAGGTAGAACTAGGCAAGTGGTAAGAGTCATCAAGCCTA
TGTGTATCTGTGAAGAGCAGTGTGCACTGGTTTTTCCCGTTTATTGGCAATAGTCTTGAG
GCAGATGCTATCCTCATTTTTCAGGTGAGTTGTAGATTTTGGGCCAAGATCACATTGTAG
GGAAGTCTAGCTTAGGTTTAGATTTGATGCCACCTGCACTGCTTTCCAATAACTACACAA
GTATGTATAACAACCATTATTTTATACTGTCACATTAGTGCATTATGGTGTGCTTTATTA
ATGTTGATGGCTTCTATTCTGGATGAGGAAGCTGAGGACCCAGGGGATGCAGATCCAGCA
AGGGCTTTTGACAATACTTGCTAAGATCAAGGGTAGCGTGCCTGTAGTACCCAGCTACTC
AGGAGGACTGCTTGAACCCAGGGTTTTGGAAGTCAGCTGGGCAACATAATGAGAAATTGT
CTCAGACTTAAAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCAAAGGCAAGCCTCATATTCTCCCCTCCTCAAGTGAAGT
ACCTGGCCTTCCTCCGCAAGAAGGATGAATACCAACCCATCCGAGGCCCGTACCACTTCC
CGGGCCCCCAGTCGCATCTCTGAAGGACTGTACGAGGTGAGCTGAGCGCGGGGCTGTGGG
TGGTGGCAGCAGGCAGCCAGTGATGAGGACGTCTCCCACTCGTGTTCGAGTTCCCCAACC
ATGAGATGACTCCACATGCACTACCATCTGAGGCCGCCCCCATGCCTGCCCTGGTGGGGA
AGGGTGAACATCCTCTAAGCTCCACTGAGGTCTGGCATCCTTCTGCCATAGGCATGCTGC
CCCACAAGACCAAACGAGGCCAGGCTGCCCTGGACCGCCTCAAGGTGTTTGATGGGATTC
CACCACCCTACGACAAGGTGAGCCACACCAAGCCCCCAGCACAGTGTCGTGCATCCAGCG
TCCATGATGTTACGCAATTACCTACATTGTTTGAGCCTCATGAAAACATAACTGGCTGAG
ACGCCTACTGCAGCCAGCCTCCTTTGCCTAGTGTCTCTGCACTAGGTCTTTAAGCCCCTC
TCCTCCAACAGAAAAAGCGGATGGTGGTTCCTGCTGCCCTGAAGGTTGTGCGACTGAAGC
CAACAAGAAAGGTGAGTTCCAGGTTGAACAGCTCTAACTTGGTTTTATGGTCTGCTGGGG
TGAACCTGAGGTTCAAGACTGGCAAATGATGTTTTTTCTCACGATGGTCTGCGGATGCCA
CTGTGTGTGTGTGCAGTGCCGAGAACGCTAAAGGCTTAGCTGATGCCAGGAGCAGGGAGC
CTTTCCACAGGATGTGTGTGTCGCCTTCACATGTGGGCTTGCTGGGGACTGAATTATTAT
TCCCTTCCCATGATCCTCTAGGACAGTTACTCCCCTTGTGACCACCATGGCCTCAGTCCA
GGCTCTTTAGGTTAAGAGGACTCCCATGTCTCCATGCCCTTAAAAACTTTCTCTGCCCCT
CTAGTTTGCCTACCTGGGGCGCCTGGCTCATGAGGTCGGCTGGAAGTACCAGGCAGTGAC
AGCTACCTTGGAGGAGAAGAGAAAGGAGAAAGCCAAGATCCATTACCGGAAGAAAAAACA
GCTTATGGTGAGGGCAGGGAGTTACCCTGGAGGGGACTGTGCTTGTGGGTGGGCCAGGCT
GGCAAAGTCTTACCCTAGAAGGTCTGCCTTCATCCCAGCCTGAGGTGGAGAACCAGCTCC
TAAAGCCATTGTGTGTTTTTAACCCCACAGAGGCTACGAAAACAGGCAGAAAAGAATGTG
GAGAAGAAAATTAACAAGTTCACAGAGGTCCTCAGGATCAATGGACTCCTAGTCTGAGCC
CAATAAAGACTGTTTATGCCTCATGTGTGGCCTGGCCTGCCCTTCCTCCATCGCCACCCT
GGGATATGGGGGACCCAGTACAGCTCTCTGGGTTCACAGGCAGCTTGGGACCTGGAAAGC
TGACACAGAGAAGGGCCTTAGCCTTGGTCTCTGCTTCTGTTTCAGAAGGTTTCTTAAGAG
TTGTATGGTCAGAATTTATGACCTGCTAATTCATGAATTTTTAAAAAATGATAGAACTAC
CAGTTACTTGCAGTATTTTAAAAAAAATGAGCTGGAACACTAAGCGGGGGTCTCCTTGGC
TATAGGGGCACCCATCTGTCTTAACCATGTGGCCATCCTATACTCTGTAGCTGACAGAAT
GGGAGAGTACCTGCTGAAGTGGGCCAAGTTTTAGAGGTGCAAAGACTGGAAAATGCACTA
CCCCTTTCCTTAACATCTGTTTTGTGATCGAAAGCAAATAAATTATTTTGAAGAAACATG
CGTCTTGCATATGTCCCCTATGAGTGGCCTCAGCAAACAAGCTCCCGCAGGCACCTTACA
CAAAGACCAAGTTCCTCCTGGGACAGCCTGCAGTGTCCTAATAACCTGAAGTTGCCCCTT
TCCAGTTCAACTGCAAAGTATGTGATTGCCACAATGCCCCCTACTGCCTGACTCCAGGGG
TCAAAGCACCACAGCAAGTGAATTGGTTATTAAATAAGTACGTTAGGCCTCACCTAAAAT
ACATGTGCTGCTCTGCCAGTGTGAACCCCTGAGGGCAAAGGGCCTGCCTGGGTAGCCCTT
TACCCATCTCAACAGTCACCAGCACCCACAACTGTGTGTGATGTGGGGAATTGAACCCAG
GACCCTACCATGCCGGGTGAGCGCTTTGCCACCGGACAGCCTAATGAAATACAACTCAAA
TATTGGGGTTCTCGGTCGCAAAAGTCACATTTCAAATGCTACTGCCCACCGAGTTAGAAG
CGCAGGTATGCAATAGTTCCACAATCGCGGTAAGTTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 2749..2821, 2922..2987, 3414..3440, 3442..3461, 3464..3479, 3481..3497, 3503..3515, 3711..3796, 3971..4030, 4384..4506, 4650..4736
1001..1015, 2749..2821, 2922..2987, 3414..3440, 3442..3461, 3464..3479, 3481..3497, 3503..3515, 3711..3796, 3971..4030, 4384..4506, 4650..4733
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved