Spermophilus_tridecemlineatus Locus TRO
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus TRO
Spermophilus_tridecemlineatus
TRO
GeneScaffold_393
SNORA11
9071..9199
14884
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAATCTCCCTCTCCCTCTCCTTCTCTCTCTCCTTATCA
TTCTCCCCAAATTCAGCCTATTTCTCTCAGGCTCAGCTTTTACTTGGCTTTCCAGAAAGA
TGGATAGAAGAAATGACTATGGTTATAGAACAACGGTGTTCCAGGTGAGGCCTCTCTGCA
TTCTTATCAGGCTATCTGCCGTGTCCTGAGTTAATTGCATGTGAGCCCCTCCCCACCCTG
TATTAGCATAATTGCCTGCCTAATCTGTCTCAGTTCTCCTTTGCATGGTGGAAGGGGAGG
GGGAGGAGTGGAAAACCTGCCTGATTGTATCACCCCCTTCAATCAAACACTATTCAGAAG
AAAGAGAAGCTTTCTGGAAAGGGGTGGGCATAGGGAGGCAGGTAGCCCAAAGGATCATAA
TCCTAAGTGTGTAGGGCCCTCTGCCTCCCTCTGGGAGCCTGGGGCTTCCCTTCCCTCCAG
ATGTAGAGACCGAGACCACAGAAGAGGACAGTGTCTTGCTGATGCATACCCTGTTGGCGG
CAACCAAGGACCCACCTGTTGCCAACCGACCTAAGAAAAGCAAGACCAAGAAGACTTCTC
TTAAGGCTGTTACTAAGTCTGCACCTGCTGCCTCTCCAGTCCCAACTGCCAATGAGATTG
CCACCAACAAGCCCAAAATAACTTTACAGGCTTTAAACTTGCCCATGCTCACTCAGATCA
GCCAGTCTTCAGCTACTACTGAGGTAGCCAATATTCAGGCTTCTTCAGTCACTGTTCAGC
CTAAGAAAGCCAACAAGACAAAGAGAGTTTCTGCCAAGGTAGCTCAAGGCTCCCAGTCCC
CAACTGGGAGTGAGGGTGTTACTACCCAACTCAAGTCACCCTTGCAGACCCTAAACCTAC
CAGTGATTTCACAGACAATCCAAGGTTCCAGTTGCCAGTGAGTCAGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCAAGAAGGCTGC
CAATAAGACCATAGCTAGTGCCACTGAAATCTTACCAGCTCCAACTACTATCCACATAGC
TACTACCCAAGGCCAAATTACCAGTGAGACAGCCAATATCCAAGCTACAGCAGCCTCTAT
CAGAACCAAGAAAGCTCCCAAGGCCAAGAAGACAACTGCTAAGGCCCCAAATACTGACAC
AGAACATCTAGAGTCTCCAAATTCTACTGAGGCAGTGAGCAGGCAGATTGAGGCCACAGC
AGCAGTTCTCCGGCCCAAAAAGCCCAAAGGAAAGAAGATTGTCAATAAAGGCCCAAATTC
TGCCTCTGAGATCACTGAGGCTCCACCCACCACTCAGATGGTTACAAACCAAACCATAGT
AGCTACTATTCGAGTCAAGAGAGGGTCTAGGGCTCGAAAGGCTGGCACTAAGGCTCGGGT
AACTGAAAGCCAGACTCCAGTTGCTGACCAGGGGGCTCAGGTGAAGATGGCTGCCTCTCA
GACCAGCATAAGCGCCCTTGAGACTCAGGTTGCTGCTGCTGTCCAGGCCCTGGCAGATGA
CTATTTGGCTCAGTTGAGTCTGGAGCCCACAACTAGGACCCGGGGCAAGAGAAACCGAAA
GGTGAGATCTCTGACAGCATCCTTAAGTTTGTAATTCTTTTCCATTCCTGTTTTCCTTGT
TTGCTCATTTCTTCTATAAACATTTACTGAGTCTTTTTACTAGTCCCTGTGTTCATATAG
GATATGGGAGATGCTGATAAAAATGGAATATAGTTTGTGACCAACTAGCAGTTCACAGAG
TGGTGGGGAAGTAAGATATCTATATACTTAGATATAACCTGTATGTAATTCACCTTGTAT
TTACATAGTGGTCACCATGTTCCAAACTTTGCTTTGGATATATTTACAAAAGCCATGCCT
TTATATCTTGAAAGGGATACAGGGACCGTAAGTTCTAGTTTTACAGATAAGTAAACTGAG
TCCCACTGAAGTGAATTTACTTGTCCAGGGAATACAGCTAGCAGAGTCTAGTGATACCAA
GGAAGTAGAGCTGTCCCAGGCCCTTAGGTTATTCTAGCCTGAACAGAGCAATTAAATTTC
TGCCTGGAAGATAGTGGAAGAAAATCCCAGGACTCTGGGTAGCCAATGGCAGGGTCAGGC
CCCACTGTAGGGGGGAGTTGAAGGGGACTTGCTGGAAGAGACAGCCATATATTTCACCTG
GTAACTCTGGACCTTTCTTCTTTCTCGTGATGAAGTCCAAACATCCAAATGGGGATGAGA
GAAGTGGCAGTAATTATAGGCGGATCCCATGGGGCCGGAGGCCTACGCCACCACGAGATG
TGGCCATTTTGCAAGAAAGGGTAAGAATCCAATGCTGCCTCCTCTGTTTTCTTCCTCTGC
CTCTTTTCTGACATCTTACAAGTATATTGAGATCTCACTATCTTTCCCTTTTTTCAGGCA
AATAAATTGGTGAAATACCTGTTGGTTAAGGATCAAACAAAGATCCCCATAAAGCGCTCA
GGTAGTGTCCTACCAATCCTCCTCTTTGAGCCACCCCATCCCATAGTCTGGGGTTAATCC
TTTACCTTTATGACTTGCTTATTCTCTAATATCTCTACCATTGCTTTCCTCCTACATCAT
CAGAGCTAGCATCTTTTAATAACCTAGTTCAAGGCTCTGATTGCACTAACCCCACTGGGC
TGACAAAAGGGCTATTAAGTTGGGGCTGGGTTGTGTCTCAGTGGTAGAGCACTTGCCTAG
CATGTGTGAGGAACTGGGTTTGATTCTCAGCACCACATATAAGTAAAAATAAAAATAAAG
GTCCATCAACAGCCAAAAAACCCCATTCTTTTTAAAAAAGGGCTGCAGCTCTATGGCCCA
TGCTCAGACCAGGTTTTCCTACCTCTCCCTTCTTGTAGACATGCTGAAGGATGTCATCCA
AGAATATGATGATATTTCCCAGAGATCATTGAACGAGCAAGCTACNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAGGCTTCCTAATG
TAGTGGATCATGATGCTCCAAGGACAAGAAAAGTGATATACTCTGCATATATATCTTTGT
GTAGTGCTACTCCTCCTACATGCTCTGTGGATTTAGAAAAGAAAAAACTGCTGTCTCTGT
CCTCAAGGAGTACACAATCTAACTGAGAATGCTAGACTTACCCCTAGGAGGTAATCAGTC
CAGGCAAGGAATGACCACGAATAGAATCATGGCTTAGACTTGAAATCAGAATTGCAGAAT
CACTATAGACTCACATGAAAGAAACCATATCATGGCTCCACCTCCCAAGATCATGAGAAG
TGGCATCACTGGGTTTCTGCCTAGAATTTGCTCAGGTATGAGGGCTCTGGGAGAGAAGGG
ACTCATATTGACTGGGTGCCTGTGTTGTGCCCAGTTGACAGGCATTCCTTCATTTTCATG
GCAACCTGGGGTGGGAGGTAGAACATGATTTTCCAATTTTGCTAAATGTGAGACTTTGAT
TCATGGGTCTTAAGTGCCTTGCCTGGGGTCACATGGAGTTGTAAGCACAGACAGGACAGA
ATTCTCCAAAATCTGAGGGATCTGGGAGAGTCTAGACTTTTGAGTTGGCTGGTGTGTCTT
GTATGTGGCTCTAGGACATAAACCTTCTCTGTCCTATTATTCCTTTAGGACCAAGGATAC
ACCCAAGCTGGGTCTCCTCATGGTGATTCTGAGTGTCATTTTTATGAATGGCAACAAGGC
CAGTGAGGGTGAGTGGCTGGGCATGCAGCTGAATGGGTGGCTGTGCTCTGAATTCCATGT
GTTCATTTTCTGTCCCTGTCCCCTCTTGCCTCCCCTTGCAGCTGTCATCTGGGAGGTGCT
GCGCAAGTTGGGGCTACGCCCTGGGTATGATTGGGCTCTCTCAGAAACATGCTGTCCGTG
TTGTCCTTTGGCAAGAGAGGACGGTCAACCGGATTGCATCAGCCTGGTGGTCTGGTGGCG
CGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTGATTGGGCTCTCTCAGCGCTTGCTGTCCGTGTTCGTCTCTTTGGC
AAGAGAGGACGGTCCCAGGATTGCATCAGCCTGGTGGTCTGGTGGCGCGGGTGGGGGGTG
CTGGGCTGGGTGGATGGGGAAATGATTCTGAACTCTTTACTCCCTTTCTCCTTTATGTCC
TCCATCTGTTCTGAGCTGAGATGTAAGATAAACCTTCAGGGATCCCTGAGAAAGAGCCAT
CTGGCCTCCGGCTGCTTGCTTCTTCTAGTGGCTATGTGCTCACTACTTTCTTCTCTTCGT
TGAGACTACCCCATGTGCTAGAGAGGTTTCCTTCCAGTTGGGAAATGCCTCTGCACTAAT
CTGGGCAGTTTTGGTCTGTGTTCATGGGTTATTTTTCCCATTGCCAGGGTGAGACATTCA
CTTTTTGGGGAAGTGAGGAAGCTCATCACAGACGAATTTGTGAAGCAAAAGTAAGTGGTG
TTTGGGGGTTTTATTTGACCCTGATGTGTTCTGGGGGTGCTAGTCTAGTTCAGAAAGTGC
TTAGTCAGTGCCTTCTTGATGCTGTCTTTAGAGGGATGAGCATCTTGTGTTCTAAAAATG
AGTCCTGTCTAAAATTCCCATGGAGGGACATATCCAGGACTAGGAACAGACCAATACAAT
GCCCTTGCAATGGGGTGTGCTCAGAGCAGGGGGCCTGAAGAATGGCTTCTCTGTTTACAA
CACACCCAACAGCAATCTGGGTTTACTCCTCACAGGTGGCAGGATACATTGGCCATCCTG
TGACATCATGCCCTATATACCCCAGGTGCCTTTGCACAGGGTCATTGGGAAATGGTCTTG
GAAGAACAAGACCATGAACTATGTGTGAGAATGAATCTTGGGCTGGAGAGTCTTGGAAAT
ACCTCTGTAGGGGCTATTTAGCATTTGTGTAGAAGAGATTGTCATATGAGACCTAGTGAT
TAAACAACAGGTTTGCTTGGCTAGAAGTAAGCTTTGTTTCCTTTCCAAGGTACCTGGAGT
ATAAGAGGGTCCCCAACAGCAGACCACCTGAGTATGAGTTCTTCTGGGGCCTGCGCTCTT
ACCATGAGACTAGCAAGATGAAAGTCCTCAAGTTTGCATGCAAGGTAACATAGCTGCCTG
ATTTGGAATGTTAAGGGAATGGCATGTCTCTGGCTGACAAAGCCTGTGTGTAGTAATAGA
CAGGTAAAGAACAACCTGCAGTTTATATGTAAACATATGAAGCCTCATTAATATCCCAGA
ATGTTGCTAGAAATATAGTTTACATTGTTTTATTCATTCCTATGCTTTGTATTAATTAGT
TCAGGCTTCTATAACAAAATATCATAAACTGAGTGGTTTAAAAACAGAAATTTGTTTTCT
CACAGTTATGGAGGCTGAGAATCCCAGATCAAGGTCCTGCACAGTTGGTTTCTGGTGAGG
GCTCTCTTCCTGGCTTAGAGAAAGCTGCCTTCTTGCAGTGACCCTTCTTACAAGGACACT
AATCCTATTGGATGAGGGCCCCACCCTTAAGACCGTATTAACTAACTATAAATTACCTCT
ATAACAGCCCTATCTCCCCAAACAGTCACACTGGGCATACTGTCATTTCCCATATTATGA
ATGAAGACACTTGGGTTCAATAAAGTTAAATAACTTGTCCATAATTTTATTGTTCCTAAG
TTATCAGAGCTGAAATTAGATCCCAGGACTGACCCATGACAGAGCCTTAATAAGAATTTT
AAAAAATTAATGCTCTTAATTTTATCCAAAGTTCTTAGTAGGTGCTTCACATATCATTAC
AAAGGTTCTTTTCTTTATAATAATTATTATTTCCATTTAAGGTGCAGAAGAAGACCCCAA
AGACTGGGCTGCTCAGTATCGGAGGCAGTGGAGATGGAAGTCCAAGCTGCAGCTGTGCTG
TGCTGAGCTGAGCCAGGGCTGAGCAAGAGCCCAATGGGGATTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAATAAAAAAAAAAAGGA
AGAGATAAAATATAAATAAATACCTTTTTGGTGTGGGTGGGGGCATAAAAAGGGAGATAG
ATAAGAAGAGAGAAAAAAAAAAAAGAAAAAAAAATTTCTGTGTTTTTTACCGTTAGATTT
ATATAATATTATTCTATTTAACCTAACAAGATCGATGCTGTACCAAGACGTCTCTTTCCC
ACTCCTCGGGCGCCAAACCCTCGCCGAAACCCCCCCCCACCCTCCCCCGCTCCCGTCCTC
CTCCACTTCAATCCGTTCGTAACCTCTATTGCAAAATATAAAAAATAACTTCCGGGCCTA
CGCGGGTTAACTGCTTTTCATATCTTCCCTGTTTAAAAAATGAGGGAGGGGTCGGCAAGG
GGGGGGGGATTTAATAGTTGCTCAAAGCACCTACCCGGTTTAGGTGGAGAATTTAGCACC
AGTGCTGCTCAGTGGGGCACTTAGTACCACTACTGACTTTGGCAGTACTCACAGCAACAG
CATTGGCTTTGGCAGTGCTCCCAGCACCAGCGTCAGCTTTGGTGGTGCTCACAGCACCAG
CCTCTGTTTTGGTGGAGCTCCCAGCACCAGCCTCTGCTTTGGCAGTGCATCTAACACCAA
CCTATGCTTTGGTGGCTCTCCTAGCACCAGTGCCTGCTTTAGTGGTGCCACCAGTGCCAG
TTTTAGTGATGGACTCAGCACCAGTGCCGGTTTCAGCTTTGGTAATGGGTTAAGCACCAG
TGCTGGATTTGGAGGTGGACTGAGCACCAGTGCTGGCTTCGGTGGCAACCTAGGCACCAG
TACTGGCTTCGGTGGCGGCCTAGGCAGTGGCTCCGGCTTCGATGGTGGCCTAGGTACCAG
TGCTGACTTTGGTGGCGGACTAAGCACCAGCACTGGCTTCGGTGGCGGACTAGGCACTGG
CACTGACTTTGATGGTGGACTAGGCACCGGCACTGGCTTTGGTGGTGGATTAGGTACCAG
TGCTGGCTTCAGTGGCGGACTGGGTACCAGCACTGGCTTTGGTGGCGAACTAGTCACCAG
TGATGGCTTTGGTAGTGCACTGGGTACCAATGCTGGTTTTGGCGGCACACTTGGCACTGG
TGTGGGTTTTAGTGGTGGCCTCAGCACCAGCGATGGCTTTGGCGGTGGGCCTAATGCCAG
CTTTGACAGAGGACTGAGTACCATCATTGGCTTTGGCAGTGGTTCCAACACCAGCACTGG
CTTTACTGGCGAACCCAGCACCGGCACCAGCTTCAATAGTGGACCCACTTCTATTGTTGG
CTTCAATAGTGGACCGAGCACTGGTGCTGGCTTCTGCAGTGGGCCAAGCACTGGTGGCTT
TGGTGGTGGACTGAGCACTGGAGCTGGCTTTGGCGGACCGAGCACCGGAGCTGGCTTCGG
TGGTGGACTGGGCACCAGTACAGGCTTCGGTGGACCAAGCAGCAGTGCTGGCTTCGGTGG
TGGACCAAGCAGCAGTGCTGGATTCGGCGGTGGACCGAGCACCGGTTCTGGCTTTGGTGG
TGGACCTAATAGCCTTGGTGCCTGTGGCTTCTCCTACGGCTAATGAAGTTTCAGGTGAAT
GCCATATTTCCATAGCCAGAGTCCATGGGGTTGGGTATAATATTTGGGATATTATATTTA
GAAGAAACCATGAGGGAGGGGGGCTGAGTGGGAAGATGAAGGCAATGAAGGAAGTATGAG
AAAACAGTATATTTGGTCCTAAAATGTTTTTGGTGTTTCGTTTTCAGGTTTATTCCCCAT
GTTTACAGACACCACTAATAAATTGCAGCAGTCTTTCCCATGGAGCCAAGGTACAGCCTT
GGAATCTTTGTCCACACAGCAATCCTAAGCAGCTACTACCAATCAGCTGAGGGTGACATG
CTTTGAAAAAAATCTGTTCGCTGTTCTTGCTTTCTTGTTTGCTTTCTGTGTGCTGTCATA
TTTTGGTATTAGAGTTATTAAATTTGCAAAATGAATTGGAGTTTTTTTCTTTTAATTTGC
TTAGGTAATTGTGAGTGACACTTTGGGTTTGTAGAAAAGCTAGAGATCAGCATAGCTCTT
TTGGGAATGTGGGGTCCAGCTTCAGGCTAAAAGGCAGGTATTTCTTAAGTGGGGGGGAAG
CCTAGGAAAGCATGGCAAACCCGAGGATAATAGCTTGAAAAAAATACAAAGGGGGGGAAG
CCAAAAGCAGAATGCAAAGATAAAGAGTTCTAGAGTGTAAGTACAGATTCATTTTGAATT
ATCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1402, 1404..1478, 2629..3240, 3875..3979, 4077..4140, 4538..4569, 4572..4616, 5406..5497, 7308..7387, 7481..7523, 8807..8869, 9409..9523, 10241..10249, 10252..10278, 10281..10313, 10316..10318, 10321..10323, 10326..10328, 10331..10339, 10342..10350, 10353..10361, 10869..12133, 13038..13053, 13056..13085, 13087..13556, 13617..14001, 14086..14202
1001..1402, 1404..1478, 2629..3240, 3875..3979, 4077..4140, 4538..4569, 4572..4616, 5406..5497, 7308..7387, 7481..7523, 8807..8869, 9409..9523, 10241..10249, 10252..10278, 10281..10313, 10316..10318, 10321..10323, 10326..10328, 10331..10339, 10342..10350, 10353..10361, 10869..12133, 13038..13053, 13056..13085, 13087..13556, 13617..14001, 14086..14199
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved